Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000004661 (Arid3b)
Chromosomal location
Chr 9: 57638269 - 57684600 (-)
AT rich interactive domain 3B (BRIGHT-like) Gene [Source:MGI Symbol;Acc:MGI:1930768]
Mm.409575 Mm.425588 
Q3V3M5 B2RWY2 
Human Ortholog
ENSG00000179361 (ARID3B)
Omim not available
UniTrap UNI13584
Vector Insertion
Chr 9: 57681422 - 57682040
Public Clones CMHD-GT_402D4-3 (cmhd) CMHD-GT_282C01-3 (cmhd) CMHD-GT_305F02-3 (cmhd)
Private Clones OST289950 (lexicon) OST251904 (lexicon) OST116647 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI8019
Vector Insertion
Chr 9: 57658288 - 57681422
Public Clones (sanger) RRJ028 (baygenomics) PST17793-NR (escells) PST22884-NR (escells)
PST22826-NR (escells) PST24787-NR (escells) PST17468-NL (escells) PST20183-NR (escells)
PST20631-NR (escells) PST24091-NR (escells) PST23091-NR (escells) IST14054C3 (tigm)
IST14133A7 (tigm) IST14217F2 (tigm) IST11726B8 (tigm) IST12298H12 (tigm)
IST14829F8 (tigm) IST13787H9 (tigm) IST11386D12 (tigm)
Private Clones OST449095 (lexicon) OST424270 (lexicon) OST412485 (lexicon) OST369938 (lexicon)
OST286169 (lexicon) OST174628 (lexicon)
Severity of mutation (?) Insertion after 63% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI5164
Vector Insertion
Chr 9: 57657967 - 57658045
Public Clones RRB007 (baygenomics) YTC227 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 71% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI24858
Vector Insertion
Chr 9: 57653347 - 57657971
Public Clones (ggtc) IST15077B4 (tigm) IST10226B5 (tigm) IST15077B3 (tigm)
Private Clones OST203452 (lexicon) OST196551 (lexicon) OST196472 (lexicon) OST196347 (lexicon)
OST196307 (lexicon) OST196262 (lexicon) OST196261 (lexicon) OST196253 (lexicon)
OST196210 (lexicon) OST196030 (lexicon) OST195943 (lexicon) OST195885 (lexicon)
OST195041 (lexicon)
Severity of mutation (?) Insertion after 80% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI17525
Vector Insertion
Chr 9: 57646033 - 57653237
Public Clones not available
Private Clones OST441134 (lexicon) OST431227 (lexicon) OST197616 (lexicon) OST191140 (lexicon)
Severity of mutation (?) Insertion after 40% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI18867
Vector Insertion
Chr 9: 57644278 - 57644596
Public Clones not available
Private Clones OST412761 (lexicon) OST249000 (lexicon) OST199767 (lexicon)
Severity of mutation (?) Insertion after 82% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI12032
Vector Insertion
Chr 9: 57643913 - 57644160
Public Clones A062C06 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 82% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI36879
Vector Insertion
Chr 9: 57642842 - 57643913
Public Clones W009D11 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 82% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000098686


























NI12032 - - UNI18867 -  - UNI12032 - 
Transcript ENSMUST00000114165



























Transcript ENSMUST00000004780














































Transcript ENSMUST00000052570









ACCTCTTCATCTTCATGCAGAAGAGAGGTAA - UNI5164 - - UNI12032 - - UNI17525 - - UNI18867 - - UNI24858 - CCCA







For any suggestions or comments, please send an email to