Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000007892 (Rplp1)
Chromosomal location
Chr 9: 61761091 - 61762345 (-)
Description
ribosomal protein, large, P1 Gene [Source:MGI Symbol;Acc:MGI:1927099]
RefSeq_dna
NM_018853 
RefSeq_peptide
NP_061341.1 
UniGene
Mm.428782 
MGI
MGI:1927099 
Uniprot/SWISSPROT
P47955 
Uniprot/SPTREMBL
Q58E35 
Human Ortholog
not available
Omim not available
UniTrap UNI3795
Vector Insertion
Chr 9: 61761329 - 61761694
Public Clones XP0164 (sanger) CMHD-GT_397D7-3 (cmhd) CMHD-GT_384G3-3 (cmhd) PST19617-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 43% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000008036
Sequence
TTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCCGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGC

AGTCTACAGCATGGCTTCCGTCTCCGAGCTCGCTTGCATCTACTCCGCCCTCATCCTGCACGACGACGAGGTGACGGTCACG GAGGATAAGATCAATGC

CCTCATTAAAGCAGCTGGTGTCAGCGTCGAACCTTTCTGGCCTGGCTTGTTTGCCAAG - UNI3795 - GCTCTGGCCAATGTCAACATTGGGAGCCT

CATCTGCAATGTAGGGGCTGGTGGGCCCGCTCCAGCAGCTGGAGCTGCGCCTGCTGGTGGTGCTGCTCCATCCACTGCCGCCGCCCCAGCTGAGGAGAAG

AAAGTGGAGGCAAAGAAGGAAGAGTCCGAGGAGTCTGAAGATGACATGGGCTTCGGTCTTTTTGACTAAACTGCTTTTGTTAAGTTGGCTAATAAAGAGC

TGAACCTGT
Translation
MASVSELACIYSALILHDDEVTVT EDKINALIKAAGVSVEPFWPGLFAK - UNI3795 - ALANVNIGSLICNVGAGGPAPAAGAAPAGGAAPSTAA

APAEEKKVEAKKEESEESEDDMGFGLFD

For any suggestions or comments, please send an email to unitrap@crg.es