Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000019659 (Ccdc12)
Chromosomal location
Chr 9: 110559057 - 110614094 (+)
Description
coiled-coil domain containing 12 Gene [Source:MGI Symbol;Acc:MGI:1919904]
RefSeq_dna
NM_028312 
RefSeq_peptide
NP_082588.1 
MGI
MGI:1919904 
Uniprot/SWISSPROT
Q8R344 
Human Ortholog
ENSG00000160799 (CCDC12)
Omim not available
UniTrap UNI1979
Vector Insertion
Chr 9: 110559163 - 110594819
Public Clones AR0321 (sanger) (sanger) CC0253 (sanger) AQ0500 (sanger) AG0187 (sanger)
RRT040 (baygenomics) RRT532 (baygenomics) D104C04 (ggtc) CMHD-GT_483D5-3 (cmhd)
FHCRC-GT-S3-5B1 (fhcrc) FHCRC-GT-S4-1B1 (fhcrc) IST14118D12 (tigm) IST13000A10 (tigm)
Private Clones OST425959 (lexicon) OST395701 (lexicon) OST395430 (lexicon) OST392421 (lexicon)
OST389942 (lexicon) OST381724 (lexicon) OST367871 (lexicon) OST366109 (lexicon)
OST338970 (lexicon) OST321571 (lexicon) OST270189 (lexicon) OST123570 (lexicon)
OST115805 (lexicon) OST85583 (lexicon) OST66624 (lexicon) OST56090 (lexicon)
OST1653 (lexicon)
Severity of mutation (?) Insertion after 19% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI287
Vector Insertion
Chr 9: 110594888 - 110610949
Public Clones GC0468 (tigem) RRC231 (baygenomics)
Private Clones OST447099 (lexicon) OST440597 (lexicon) OST193153 (lexicon) OST82597 (lexicon)
OST6694 (lexicon) OST2331 (lexicon)
Severity of mutation (?) Insertion after 32% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI26849
Vector Insertion
Chr 9: 110611030 - 110612397
Public Clones not available
Private Clones OST91593 (lexicon)
Severity of mutation (?) Insertion after 49% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI22926
Vector Insertion
Chr 9: 110612460 - 110612630
Public Clones not available
Private Clones OST281035 (lexicon) OST278821 (lexicon) OST222493 (lexicon)
Severity of mutation (?) Insertion after 61% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI17958
Vector Insertion
Chr 9: 110613667 - 110613754
Public Clones not available
Private Clones OST432821 (lexicon) OST376865 (lexicon) OST321371 (lexicon) OST298792 (lexicon)
Severity of mutation (?) Insertion after 84% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000019803
Sequence
CTCCGAAAAGATGGCGGCTGCTCCTGCCGGTGTGGGCCGCCTAGAGGAAGAGGCGCTGCGGCGGAAAGAACGGCTGAAGGCCCTCCGGGAGAAAACCGGG

CGCAAG - UNI1979 - GACAGGGAAGATGGGGAGCCACAGACCAAGCAGCTCAGAGAAGAGGGAGAGGAAGTTGGGAAGCACAG - UNI287 - G

GGACTCAGGCTCCGGAACTATGTCCCAGAGGATGAAGACCTGAAGAGGAGGCGGGTCCCCCAGGCCAAACCAGTGGCAG - UNI26849 - TGGAGGA

GAAGGTGAAGGAGCAGCTGGAGGCAGCCAAGCCAGAGCCTGTCATTGAGGAAGTG - UNI22926 - GACCTGGCCAACCTGGCACCCCGGAAACCTG

ATTG GGATCTCAAGAGAGATGTGGCCAAGAAGCTAGAGAAGCTAGAAAAGCGGACCCAGAGAGCCATCGCGGAGCTGATCC - UNI17958 - GTGA

GCGGCTAAAAGGCCAGGAGGACAGCCTGGCCTCTGCAGTGGATGCCACCACCGGACAAGAGGCTTGTGACTCTGACTGACATGTTGTCCGTGTCCCATCT

GATCTGTTCAGCACACACATCCTGTGGGAAGATGGTCTCAGGCAGGGAGGGGGTTAGGCTGGCCAGTACTTCTGGGTCTTGAGAACTGAGCCAACCTACT

GAGTCTCAGTTTCTGTTGGTGTGACCTGTTCATCGCCCAAGGGTGCCCACCACGCCGAGTGGCTCAAAGCTGGGATCTGTACATATGTATGCAAACTGAG

CTTTTTTCAACTTCTGCAAATAAACCTCTATTTAGT
Translation
MAAAPAGVGRLEEEALRRKERLKALREKTGRK - UNI1979 - DREDGEPQTKQLREEGEEVGKHR - UNI287 - RGLRLRNYVPEDEDLKRRRV

PQAKPVAV - UNI26849 - VEEKVKEQLEAAKPEPVIEEV - UNI22926 - DLANLAPRKPDW WDLKRDVAKKLEKLEKRTQRAIAELIR - 

UNI17958 - RERLKGQEDSLASAVDATTGQEACDSD

For any suggestions or comments, please send an email to unitrap@crg.es