Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000020694 (Tlk2)
Chromosomal location
Chr 11: 105040121 - 105143491 (+)
tousled-like kinase 2 (Arabidopsis) Gene [Source:MGI (curated);Acc:Tlk2-001]
NP_001106176.1 NP_036033.2 
Q6NZC4 B1ASU9 P70320 Q3TTG3 B1ASU8 B1ASU7 
Human Ortholog
ENSG00000146872 (TLK2)
Omim not available
UniTrap UNI10197
Vector Insertion
Chr 11: 105043106 - 105043366
Public Clones DTM063 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI24722
Vector Insertion
Chr 11: 105043366 - 105045525
Public Clones (sanger) CMHD-GT_493F7-3 (cmhd) IST10918F5 (tigm) IST11618C5 (tigm)
Private Clones OST208980 (lexicon) OST79485 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI7700
Vector Insertion
Chr 11: 105045525 - 105045609
Public Clones RRS215 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI29370
Vector Insertion
Chr 11: 105045525 - 105045609
Public Clones Ayu21-T17 (egtc)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI24717
Vector Insertion
Chr 11: 105045525 - 105045609
Public Clones not available
Private Clones OST209125 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI25340
Vector Insertion
Chr 11: 105045609 - 105068693
Public Clones (sanger) IST13213A3 (tigm) IST14166E1 (tigm) IST14262F9 (tigm) IST14770C8 (tigm)
IST11263F10 (tigm)
Private Clones OST187336 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI21320
Vector Insertion
Chr 11: 105071955 - 105082499
Public Clones not available
Private Clones OST334425 (lexicon)
Severity of mutation (?) Insertion after 17% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI3151
Vector Insertion
Chr 11: 105082668 - 105101674
Public Clones XT0781 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 26% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI37592
Vector Insertion
Chr 11: 105118266 - 105121574
Public Clones (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 63% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI30010
Vector Insertion
Chr 11: 105121667 - 105128466
Public Clones D155G11 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 68% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI2379
Vector Insertion
Chr 11: 105131110 - 105132412
Public Clones AD0182 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 81% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI20498
Vector Insertion
Chr 11: 105137774 - 105140431
Public Clones not available
Private Clones OST360537 (lexicon)
Severity of mutation (?) Insertion after 88% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI20500
Vector Insertion
Chr 11: 105140540 - 105142398
Public Clones not available
Private Clones OST360527 (lexicon)
Severity of mutation (?) Insertion after 92% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000106942





GAGAGTGGAGCGGCAGCGGCGGCAG - UNI7700 - - UNI10197 - - UNI24717 - - UNI24722 - - UNI29370 - AAATGATGGA





















AERSAAGSGRGPSREESGAAAAAE - UNI7700 - - UNI10197 - - UNI24717 - - UNI24722 - - UNI29370 - EMMEELHSLDP








Transcript ENSMUST00000106941





GAGAGTGGAGCGGCAGCGGCGGCAG - UNI7700 - - UNI10197 - - UNI24717 - - UNI24722 - - UNI29370 - AAATGATGGA






























 - UNI7700 - - UNI10197 - - UNI24717 - - UNI24722 - - UNI29370 - MMEELHSLDPRRQELLEARFTGVGVSK - UNI77









Transcript ENSMUST00000015107





GAGAGTGGAGCGGCAGCGGCGGCAG - UNI7700 - - UNI10197 - - UNI24717 - - UNI24722 - - UNI29370 - AAATGATGGA





























 - UNI7700 - - UNI10197 - - UNI24717 - - UNI24722 - - UNI29370 - MMEELHSLDPRRQELLEARFTGVGVSK - UNI77









Transcript ENSMUST00000106939






TACTTTGAAGTCCGTGTCTTGGCTCGTGAAACTAG - UNI7700 - - UNI10197 - - UNI24717 - - UNI24722 - - UNI29370 - 

































  - UNI7700 - - UNI10197 - - UNI24717 - - UNI24722 - - UNI29370 - MMEELHSLDPRRQELLEARFTGVGVSK - UNI7









Transcript ENSMUST00000092537





























 - UNI7700 - - UNI10197 - - UNI24717 - - UNI24722 - - UNI29370 - MMEELHSLDPRRQELLEARFTGVGVSK - UNI77








Transcript ENSMUST00000106936






TACTTTGAAGTCCGTGTCTTGGCTCGTGAAACTAG - UNI7700 - - UNI10197 - - UNI24717 - - UNI24722 - - UNI29370 - 



























  - UNI7700 - - UNI10197 - - UNI24717 - - UNI24722 - - UNI29370 - MEELHSLDPRRQELLEARFTGVGVSK - UNI77










For any suggestions or comments, please send an email to