Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000020717 (Pecam1)
Chromosomal location
Chr 11: 106515532 - 106611942 (-)
platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]
NM_008816 NM_001032378 
NP_032842.2 NP_001027550.1 
Human Ortholog
ENSG00000198802 (PECAM1)
Omim not available
UniTrap UNI11209
Vector Insertion
Chr 11: 106576332 - 106576499
Public Clones G032F03 (ggtc) G005D02 (ggtc) G030F04 (ggtc) G030B08 (ggtc) G003E03 (ggtc)
G038C01 (ggtc) G038E10 (ggtc) G064G07 (ggtc) G085C09 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI14271
Vector Insertion
Chr 11: 106576332 - 106611943
Public Clones (sanger) D024H11 (ggtc) 5SE285A04 (ggtc) 3SE285A04 (ggtc) FHCRC-GT-S21-3B1 (fhcrc)
IST13736F8 (tigm) IST14344E4 (tigm) IST11247E10 (tigm) IST13241A12 (tigm)
IST12032B10 (tigm) IST14251D5 (tigm) IST10511H1 (tigm) IST13125B1 (tigm)
IST10639F11 (tigm) IST13553C11 (tigm) IST10248H11 (tigm) IST12337B8 (tigm)
IST14036G9 (tigm) IST15113D10 (tigm) IST14239H11 (tigm) IST11218C11 (tigm)
IST12734C10 (tigm) IST11246F11BBF1 (tigm) IST13140F3 (tigm) IST11551C1 (tigm)
IST14651F4 (tigm) IST12019D11 (tigm) IST14841G1 (tigm) IST11992A7 (tigm)
IST14515H12 (tigm) IST12665F10 (tigm) IST14971A3 (tigm) IST13939C12 (tigm)
IST10943C8 (tigm) IST14410F1 (tigm) IST12332E8 (tigm) IST10358G8 (tigm)
IST11734E1 (tigm) IST12441A4 (tigm) IST14231G10 (tigm) IST12301D8 (tigm)
IST10725A8 (tigm) IST12028A5 (tigm) IST11266F8 (tigm) IST10607D5 (tigm)
IST10070B11 (tigm) IST13676H7 (tigm) IST10203G4 (tigm)
Private Clones OST470095 (lexicon) OST414806 (lexicon) OST411841 (lexicon) OST281283 (lexicon)
OST246117 (lexicon) OST246037 (lexicon) OST233759 (lexicon) OST216698 (lexicon)
OST207444 (lexicon) OST193769 (lexicon) OST192231 (lexicon) OST185903 (lexicon)
OST183803 (lexicon) OST183781 (lexicon) OST179440 (lexicon) OST139731 (lexicon)
OST107902 (lexicon) OST97756 (lexicon) OST68003 (lexicon) OST57234 (lexicon)
OST45106 (lexicon) OST43433 (lexicon) OST33463 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI17448
Vector Insertion
Chr 11: 106576243 - 106576332
Public Clones IST13613F10 (tigm)
Private Clones OST442757 (lexicon) OST279000 (lexicon) OST252066 (lexicon) OST187551 (lexicon)
OST177204 (lexicon) OST135451 (lexicon) OST114015 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI10799
Vector Insertion
Chr 11: 106561200 - 106576215
Public Clones (sanger) G004C05 (ggtc) G030C08 (ggtc) E324D10 (ggtc) G017F04 (ggtc)
G051D02 (ggtc) E080A12 (ggtc) G002A02 (ggtc) E324F05 (ggtc) D003E04 (ggtc)
G057C03 (ggtc) G026E02 (ggtc) G001D01 (ggtc) G038C11 (ggtc) E049A02 (ggtc)
G003F03 (ggtc) E324E10 (ggtc) G028E05 (ggtc) G051D03 (ggtc) G002A01 (ggtc)
G032E02 (ggtc) D184F05 (ggtc) CMHD-GT_517A10-3 (cmhd) IST11037B7 (tigm)
IST11749A4 (tigm) IST14348C2 (tigm) IST13058E2 (tigm) IST14392B4 (tigm)
IST13090H10 (tigm) IST12659B5 (tigm) IST12097G1 (tigm) IST11254F4 (tigm)
IST11218A2 (tigm) IST14949C5 (tigm) IST14519C11 (tigm) IST12816B3 (tigm)
IST10068F10 (tigm)
Private Clones OST412935 (lexicon) OST403351 (lexicon) OST389784 (lexicon) OST382877 (lexicon)
OST189806 (lexicon) OST151651 (lexicon) OST118697 (lexicon) OST68458 (lexicon)
OST48438 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI13248
Vector Insertion
Chr 11: 106558669 - 106560905
Public Clones CMHD-GT_320B8-3 (cmhd) (cmhd) CMHD-GT_340F9-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 16% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI12311
Vector Insertion
Chr 11: 106557344 - 106558365
Public Clones G050F11 (ggtc) G050H11 (ggtc) CMHD-GT_452C10-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 30% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI28061
Vector Insertion
Chr 11: 106552499 - 106557067
Public Clones IST14896F11 (tigm)
Private Clones OST41201 (lexicon)
Severity of mutation (?) Insertion after 43% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI14799
Vector Insertion
Chr 11: 106542345 - 106544268
Public Clones PST11705-NR (escells) PST6406-NL (escells) PST14719-NR (escells) PST1408-1 (escells)
Private Clones not available
Severity of mutation (?) Insertion after 89% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI6082
Vector Insertion
Chr 11: 106540926 - 106542345
Public Clones YHD174 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 92% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI272
Vector Insertion
Chr 11: 106533113 - 106540862
Public Clones GC0443 (tigem) RRT498 (baygenomics) RRT499 (baygenomics) XE747 (baygenomics)
PST4144-NR (escells) PST2646-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 95% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI5805
Vector Insertion
Chr 11: 106532751 - 106533055
Public Clones CSH756 (baygenomics) PST12309-NL (escells) PST2846-NL (escells) PSTVU01.E413 (vanderbilt)
PSTVU01.HE43U (vanderbilt)
Private Clones not available
Severity of mutation (?) Insertion after 98% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI14730
Vector Insertion
Chr 11: 106523315 - 106532751
Public Clones PST15257-NL (escells) PST1359-2 (escells) PST10338-NR (escells) PST14147-NR (escells)
PST9968-NR (escells) PST11351-NR (escells) PST877-1 (escells) PST2880-NL (escells)
PST2053-NR (escells) PST3348-NR (escells) PST1791-2 (escells) PST15135-NL (escells)
PST7781-NR (escells) PST14421-NL (escells) PST13851-NR (escells) PST10088-NR (escells)
PST6152-NR (escells) PST6833-NL (escells) PST9206-NR (escells) PST2619-NR (escells)
PST811-1 (escells) PST1470-1 (escells) PST0101-NR (escells) PST14309-NL (escells)
PST14185-NL (escells) PST12152-NR (escells) PST10661-NR (escells) PST875-2 (escells)
PST6819-NR (escells) PST2557-NR (escells) PST5947-NR (escells) PST33 (escells)
PST15245-NR (escells) PST119-1 (escells) PST10137-NR (escells) PST14122-NR (escells)
PST9901-NR (escells) PST11034-NR (escells) PST643-1 (escells) PST9225-NR (escells)
PST2041-NR (escells) PST5824-NL (escells) PST1785-2 (escells) PST15105-NL (escells)
PST3569-NL (escells) PST14372-NL (escells) PST12758-NR (escells) PST11423-NR (escells)
PST0082-NR (escells) PST8549-NR (escells) PST2906-NR (escells) PST2442-NR (escells)
PST562-1 (escells) PST1355-1 (escells) PST15266-NR (escells) PST3289-NL (escells)
PST14031-NR (escells) PST14175-NR (escells) PST11658-NR (escells) PST10154-NR (escells)
PST917-2 (escells) PST6818-NR (escells) PST2607-NR (escells) PST4588-NL (escells)
PST22 (escells) PST15604-NR (escells) PST1061-1 (escells) PST3188-NL (escells)
PST14087-NR (escells) PST9842-NR (escells) PST10849-NR (escells) PST1882-2 (escells)
PST9548-NR (escells) PST2367-NR (escells) PST5611-NR (escells) PST1607-1 (escells)
PST14438-NR (escells) PST14432-NL (escells) PST13414-NR (escells) PST12370-NR (escells)
PST10194-NR (escells) PST3289-NR (escells) PST8172-NR (escells) PST2589-NR (escells)
PST2963-NL (escells) PST509-2 (escells) PST1124-1 (escells) PSTVU01.HM41 (vanderbilt)
PSTVU01.HE45S (vanderbilt) PSTVU01.HO17 (vanderbilt) PSTVU01.HK25 (vanderbilt)
PSTVU01.G32 (vanderbilt) PSTVU01.HN49 (vanderbilt) PSTVU01.HK14 (vanderbilt)
IST14766C4 (tigm) IST14767C2 (tigm) IST10256A12 (tigm) IST10986G4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 98% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI12873
Vector Insertion
Chr 11: 106516477 - 106523110
Public Clones CMHD-GT_360A11-3 (cmhd) CMHD-GT_105C11-3 (cmhd) CMHD-GT_152D4-3 (cmhd) CMHD-GT_139A6-3 (cmhd)
CMHD-GT_342C7-3 (cmhd) CMHD-GT_150B6-3 (cmhd) CMHD-GT_356D10-3 (cmhd) CMHD-GT_105H5-3 (cmhd)
CMHD-GT_180A5-3 (cmhd) CMHD-GT_143E11-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 99% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI16783
Vector Insertion
Chr 11: 106515531 - 106516477
Public Clones CMHD-GT_390F3-3 (cmhd) CMHD-GT_535C5-3 (cmhd) CMHD-GT_498D6-3 (cmhd) CMHD-GT_380G1-3 (cmhd)
CMHD-GT_512B3-3 (cmhd) CMHD-GT_402A4-3 (cmhd) CMHD-GT_446B6-3 (cmhd) CMHD-GT_387A5-3 (cmhd)
CMHD-GT_502G8-3 (cmhd)
Private Clones OST454106 (lexicon) OST432716 (lexicon) OST430441 (lexicon) OST423167 (lexicon)
OST413083 (lexicon) OST405789 (lexicon) OST395422 (lexicon) OST381918 (lexicon)
OST379260 (lexicon) OST367943 (lexicon) OST357957 (lexicon) OST351449 (lexicon)
OST311007 (lexicon) OST251994 (lexicon) OST223587 (lexicon) OST204642 (lexicon)
OST158030 (lexicon) OST152469 (lexicon) OST113920 (lexicon) OST51776 (lexicon)
OST37525 (lexicon) OST16303 (lexicon) OST6899 (lexicon)
Severity of mutation (?) Insertion after 99% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI32801
Vector Insertion
Chr 11: 106515531 - 106523339
Public Clones CMHD-GT_535C5-5S (cmhd) IST14913D6 (tigm) IST12287C1 (tigm) IST10977B7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 99% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000106796












































 - - UNI14730 - - UNI32801 - NLMENRYS - UNI12873 - - UNI14730 - - UNI16783 - - UNI32801 - RTEGSLNGT
Transcript ENSMUST00000080853

























CAGTGAGATCCGGAAGGTCGACCCTA - UNI5805 - - UNI12873 - - UNI14730 - - UNI16783 - - UNI32801 - AGAACGGAA



















 - - UNI12873 - - UNI14730 - - UNI16783 - - UNI32801 - KNGRLP
Transcript ENSMUST00000103069










































AVKPINQNKD - UNI6082 - - UNI14799 - DPQNMDVEYTEVEVSSLEPHQE - UNI272 - - UNI5805 - - UNI12873 - - UNI

14730 - - UNI16783 - - UNI32801 - ENGRLP
Transcript ENSMUST00000068021
































 - UNI11209 - - UNI14271 - MLLALGLTLVLY - UNI11209 - - UNI14271 - - UNI17448 - YASLQAEENS - UNI10799









Transcript ENSMUST00000106795


































 - - UNI14730 - RSDSVP

For any suggestions or comments, please send an email to