Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000020993 (Trappc6b)
Chromosomal location
Chr 12: 60144120 - 60162445 (-)
Description
trafficking protein particle complex 6B Gene [Source:MGI Symbol;Acc:MGI:1925482]
RefSeq_dna
NM_030057 
RefSeq_peptide
NP_084333.1 
UniGene
Mm.474880 
MGI
MGI:1925482 
Uniprot/SWISSPROT
Q9D289 
Human Ortholog
ENSG00000182400 (TRAPPC6B)
Omim not available
UniTrap UNI8189
Vector Insertion
Chr 12: 60152696 - 60162142
Public Clones RRH247 (baygenomics) (ggtc) PST23846-NR (escells) IST10026A2 (tigm)
Private Clones OST463252 (lexicon) OST448764 (lexicon) OST433291 (lexicon) OST415050 (lexicon)
OST353716 (lexicon) OST283245 (lexicon) OST282701 (lexicon) OST271936 (lexicon)
OST259799 (lexicon) OST257147 (lexicon) OST180425 (lexicon)
Severity of mutation (?) Insertion after 17% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI21300
Vector Insertion
Chr 12: 60151373 - 60152627
Public Clones not available
Private Clones OST335482 (lexicon) OST277837 (lexicon) OST242031 (lexicon) OST237214 (lexicon)
OST226059 (lexicon)
Severity of mutation (?) Insertion after 31% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI20867
Vector Insertion
Chr 12: 60149194 - 60151254
Public Clones not available
Private Clones OST349387 (lexicon) OST222302 (lexicon) OST192400 (lexicon)
Severity of mutation (?) Insertion after 56% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI20026
Vector Insertion
Chr 12: 60145334 - 60149109
Public Clones not available
Private Clones OST374766 (lexicon)
Severity of mutation (?) Insertion after 74% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI17664
Vector Insertion
Chr 12: 60144664 - 60145239
Public Clones not available
Private Clones OST438661 (lexicon) OST339732 (lexicon)
Severity of mutation (?) Insertion after 94% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000021380
Sequence
CTCCACGCCCAGCGCTATAGTCTTGGCAGAGTGTGGGGCTGTCACAGGGTCTCTAGGGCCCAGTGGCGGCGGCCCCGGGGAGGGGCGCGGTCCACGGCGG

CCTTCCGCGGCCTTAGGACCCGGGTAGGCCGCTGAGCACGGCGTGCGGTGGGCGCGGGGTAACGGGAACCTCGAGTCCCGCACTGATCGGAGCCGACTCG

GCGCTGGAGGGATCGGCGGGAAATGGCGGACGAGGCGTTGTTTTTGCTTCTCCATAACGAGATGGTGTCCGGAGTGTACAAGTCCGCCGAGCAGGGGGAA

GTG - UNI8189 - GAAAATGGAAGGTGTGTTACTAAGCTGGAGAGCATGGGGTTCCGAGTGGGGCAAGGACTGATAGAAAG - UNI21300 - GT

TTACGAAAGATACTGCAAGGTTCAAGGATGAATTAGACATCATGAAGTTCATCTGTAAAGATTTTTGGACTACAGTATTCAAGAAACAGATTGACAATCT

GAGGACAAATCATCAG - UNI20867 - GGCATATATGTACTTCAGGACAACAAATTTCGACTACTCATTCAGCTGTCTGCAGGAAAACAGTATTTAG

AACATGCGTCCAAG - UNI20026 - TATCTAGCATTCACATGTGGCTTAATCAGAGGTGGTTTGTCGAACTTGGGAATAAAAAGTATTGTAACAGCT

GAAGTCTCTTCAATGCCTGCCT - UNI17664 - GCAAATTTCAGGTGATGATACAGAAGCTGTAGAGCGAGCTGGCGACTCCTGGGCAGAGCGTTGC

ACATCCTGATTTCACCTCATCGTTGGTTATCTGCGTTGGAGCAAATCGTTATCTCACCAGAGTCACATAGACCAAATCAAAGTAGACACAGGTCCTTTGA

CCATGACAGAAACTGACTGACCTATTCAGTGATTTCAGAGAACTAGACACCAAGATGCAAGGCTCTTCATTTTAAACATCTTTATTTCCATAGGTGATTA

GCATTTAACCATCAATAGGAAGTGAAACTCAGGGTGTGTTGAATTGCTGTATTAAAAAAAATGCACCAATCAGAATAGTTTGTGTTCAAATGACCAAAAT

TTGTTGAACTATAAATCTGTTTTAGTTATTTAAAAAAGCAAACCACTATGTTAAATTAAGCTTAATTTTTATTGTATTGCTTATAATTTATTTCTGTCGA

GAGAATTCATATGCTTATGTAAGGATATCATTTATACATTGTGTATATATGTGTATATATAAATACATGCATTACTGTCT
Translation
MADEALFLLLHNEMVSGVYKSAEQGEV - UNI8189 - ENGRCVTKLESMGFRVGQGLIER - UNI21300 - RFTKDTARFKDELDIMKFICKDF

WTTVFKKQIDNLRTNHQ - UNI20867 - GIYVLQDNKFRLLIQLSAGKQYLEHASK - UNI20026 - YLAFTCGLIRGGLSNLGIKSIVTAEVS

SMPAC - UNI17664 - CKFQVMIQKL

For any suggestions or comments, please send an email to unitrap@crg.es