Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000022272 (Myo10)
Chromosomal location
Chr 15: 25552280 - 25743428 (+)
myosin X Gene [Source:MGI (curated);Acc:Myo10-001]
Mm.431505 Mm.60590 
P70316 Q3TXD6 Q8R3S0 Q80TR9 Q9JJY5 
Human Ortholog
ENSG00000145555 (MYO10)
Omim not available
UniTrap UNI2514
Vector Insertion
Chr 15: 25552786 - 25595398
Public Clones (sanger) XS0985 (sanger) IST14696E6 (tigm) IST13072A12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI20524
Vector Insertion
Chr 15: 25595412 - 25596175
Public Clones not available
Private Clones OST360022 (lexicon) OST316933 (lexicon) OST37753 (lexicon) OST35603 (lexicon)
OST30961 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI21429
Vector Insertion
Chr 15: 25596280 - 25631316
Public Clones not available
Private Clones OST330323 (lexicon) OST131828 (lexicon) OST40607 (lexicon) OST38191 (lexicon)
OST37013 (lexicon) OST30582 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI1545
Vector Insertion
Chr 15: 25631476 - 25643783
Public Clones CC0258 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI32960
Vector Insertion
Chr 15: 25643972 - 25651924
Public Clones IST13532F11 (tigm) IST12552F11 (tigm) IST11627D12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI18235
Vector Insertion
Chr 15: 25652060 - 25653638
Public Clones IST10750C4 (tigm)
Private Clones OST427108 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI34909
Vector Insertion
Chr 15: 25653764 - 25654826
Public Clones IST12035C11 (tigm) IST10680B3 (tigm) IST11751F9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI30079
Vector Insertion
Chr 15: 25655036 - 25656174
Public Clones D124C02 (ggtc) CMHD-GT_510H6-3 (cmhd) (cmhd) IST11387E7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI24343
Vector Insertion
Chr 15: 25661855 - 25663742
Public Clones CMHD-GT_519H7-3 (cmhd)
Private Clones OST224318 (lexicon) OST39357 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI36422
Vector Insertion
Chr 15: 25665848 - 25666155
Public Clones IST11772A6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI35401
Vector Insertion
Chr 15: 25666417 - 25667204
Public Clones IST11772A6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI21900
Vector Insertion
Chr 15: 25667781 - 25669041
Public Clones not available
Private Clones OST314438 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI34264
Vector Insertion
Chr 15: 25669125 - 25672095
Public Clones CMHD-GT_473H8-3 (cmhd) IST13864G7 (tigm) IST13945A12 (tigm) IST13001G11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI32810
Vector Insertion
Chr 15: 25672205 - 25673930
Public Clones IST12892G7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI3479
Vector Insertion
Chr 15: 25674012 - 25682742
Public Clones AX0462 (sanger) XQ0028 (sanger) P104A12 (ggtc) H005H04 (ggtc) H004D02 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI30739
Vector Insertion
Chr 15: 25674012 - 25682664
Public Clones (sanger) IST14330H12 (tigm) IST10005C1 (tigm) IST12725C5 (tigm) IST10654E12 (tigm)
IST13145G3 (tigm) IST12437H1 (tigm) IST11392H4 (tigm) IST12614F2 (tigm)
IST12030G7 (tigm) IST10922C1 (tigm) IST11785E9 (tigm) IST14540A2 (tigm)
IST10374C10 (tigm) IST11219G5 (tigm) IST14784D5 (tigm) IST10076G6 (tigm)
IST14509E3 (tigm) IST12432H5 (tigm) IST11034C11 (tigm) IST10193F4 (tigm)
IST12071G12 (tigm) IST13424E8 (tigm) IST10877E4 (tigm) IST11781H2 (tigm)
IST12035G10 (tigm) IST11765C4 (tigm) IST14525F7 (tigm) IST13241G4 (tigm)
IST11172B4 (tigm) IST14868E12 (tigm) IST14982E11 (tigm) IST10216A9 (tigm)
IST14641C2 (tigm) IST13079F9 (tigm) IST10602C8 (tigm) IST13351D8 (tigm)
IST13644H12 (tigm) IST12267E3 (tigm) IST10252C5 (tigm) IST14248C3 (tigm)
IST13277E2 (tigm) IST14800B11 (tigm) IST11104F3 (tigm) IST14720B8 (tigm)
IST10654E11 (tigm) IST12450B4 (tigm) IST14372H2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI12120
Vector Insertion
Chr 15: 25682664 - 25683076
Public Clones W266A01 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI12974
Vector Insertion
Chr 15: 25683076 - 25705775
Public Clones CMHD-GT_354A1-3 (cmhd) CMHD-GT_337H2-3 (cmhd) CMHD-GT_354C11-3 (cmhd) CMHD-GT_330F3-3 (cmhd)
FHCRC-GT-S20-3A1 (fhcrc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI15056
Vector Insertion
Chr 15: 25683076 - 25705775
Public Clones (sanger) P139F01 (ggtc) P104A12 (ggtc) E140B02 (ggtc) E043A08 (ggtc)
E023D06 (ggtc) D111A02 (ggtc) D063G07 (ggtc) P134G12 (ggtc) M123A10 (ggtc)
E069A06 (ggtc) E035F07 (ggtc) D178H06 (ggtc) D103A07 (ggtc) D032D07 (ggtc)
P141F01 (ggtc) P116H07 (ggtc) E323C01 (ggtc) E067D08 (ggtc) E025A01 (ggtc)
D119F04 (ggtc) D068H09 (ggtc) P138G10 (ggtc) P103F07 (ggtc) E042A02 (ggtc)
E002C08 (ggtc) D041D12 (ggtc) P133A04 (ggtc) H008D10 (ggtc) E068A06 (ggtc)
E032A05 (ggtc) D100C07 (ggtc) D005D10 (ggtc) E140C07 (ggtc) E062E07 (ggtc)
E113F01 (ggtc) E036F11 (ggtc) H005H04 (ggtc) H004D02 (ggtc) E025A02 (ggtc)
D154E05 (ggtc) D086F12 (ggtc) CMHD-GT_534F7-5S (cmhd) CMHD-GT_538B1-3 (cmhd)
CMHD-GT_403E6-3 (cmhd) CMHD-GT_521E5-5S (cmhd) CMHD-GT_522H8-5S (cmhd) CMHD-GT_426A11-3 (cmhd)
CMHD-GT_493A8-3 (cmhd) CMHD-GT_534G1-5S (cmhd) CMHD-GT_534G1-3 (cmhd) CMHD-GT_524H8-5S (cmhd)
CMHD-GT_494G1-3 (cmhd) PST23200-NR (escells) PST4523-NL (escells) PST24693-NR (escells)
PST20433-NR (escells) PST22895-NL (escells) PST14042-NL (escells) PST17229-NR (escells)
IST12443B12HMF1 (tigm) IST10768C8 (tigm) IST15010E10 (tigm) IST14475C6 (tigm)
IST13894C1 (tigm) IST12783G6 (tigm) IST13640B2 (tigm) IST12372G10 (tigm)
IST12711G4 (tigm) IST11764C10 (tigm) IST12234H2 (tigm) IST14405C11 (tigm)
IST11024F7 (tigm) IST14807A9 (tigm) IST14724A9 (tigm) IST14632D4 (tigm)
IST10506E10 (tigm) IST14949B6 (tigm) IST14353F6 (tigm) IST12502D8 (tigm)
IST12732A2 (tigm) IST10884F5 (tigm) IST12738E11 (tigm) IST12003D12 (tigm)
IST14843G3 (tigm) IST13087D6 (tigm) IST14430H6 (tigm) IST10831B3 (tigm)
IST12986H11 (tigm) IST13613H11 (tigm) IST12126E8 (tigm) IST13856A4 (tigm)
IST14341D10 (tigm) IST11587A12 (tigm) IST10189B5 (tigm) IST14583F5 (tigm)
IST12988D9 (tigm) IST12635E12 (tigm) IST11784F1 (tigm) IST11622B7 (tigm)
IST13526G8 (tigm) IST10205B4 (tigm) IST14586A2 (tigm) IST14379C10 (tigm)
IST13118A9 (tigm) IST11601A3 (tigm) IST12228E7 (tigm) IST11128G3 (tigm)
IST14484C7 (tigm) IST10043C3 (tigm) IST11137G7 (tigm) IST13017A1 (tigm)
IST14656G5 (tigm) IST12267E3BBF1 (tigm) IST12977E9 (tigm) IST10156G4 (tigm)
IST14164D1 (tigm) IST14857G9 (tigm) IST14426H6 (tigm) IST14958A11 (tigm)
IST14222G12 (tigm) IST14672D6 (tigm) IST14466F6 (tigm) IST13041D3 (tigm)
IST12407F6 (tigm) IST14271E5 (tigm) IST14849F5 (tigm) IST14749C4 (tigm)
IST12443H8 (tigm) IST10667D8 (tigm) IST13082B10 (tigm) IST12769H12 (tigm)
IST12528D6 (tigm) IST15044F3 (tigm) IST12933G4 (tigm) IST14274G1 (tigm)
IST12077B7 (tigm) IST12844E8 (tigm) IST13058A6 (tigm) IST13286B11 (tigm)
IST14932D6 (tigm) IST13072E10 (tigm) IST10877E12 (tigm) IST12407F5 (tigm)
IST15079H10 (tigm) IST14787G12 (tigm) IST14158H8 (tigm) IST10653E6BBF1 (tigm)
IST12762F8 (tigm) IST14658C1 (tigm) IST10038B1 (tigm) IST13323E6 (tigm)
IST15000E12 (tigm) IST14543H6 (tigm) IST12536F6 (tigm) IST10750C11 (tigm)
IST14276H8 (tigm) IST13063E1 (tigm) IST10882E10 (tigm) IST10991E7 (tigm)
IST12605A9 (tigm) IST14154A2 (tigm) IST13117A7 (tigm) IST12379D2 (tigm)
IST12007C8 (tigm) IST12124C6 (tigm) IST14558D5 (tigm) IST14685E5 (tigm)
IST14194G6 (tigm) IST13072A4 (tigm) IST14781F7 (tigm) IST10768C7 (tigm)
IST11078D11 (tigm) IST14390F2 (tigm) IST14394F11 (tigm) IST14244B9 (tigm)
IST10761E12 (tigm) IST12953D6 (tigm) IST12229F6 (tigm) IST13114H9 (tigm)
IST12596E4 (tigm) IST14804H8 (tigm) IST13059A2 (tigm) IST10510H5 (tigm)
IST11772C3 (tigm) IST13111H7 (tigm) IST11198E12 (tigm) IST13910A8 (tigm)
IST14999C9 (tigm) IST13102F7 (tigm) IST13111B4 (tigm) IST11119G9 (tigm)
IST14118A4 (tigm) IST14431G5 (tigm) IST14433F8 (tigm)
Private Clones OST456642 (lexicon) OST453247 (lexicon) OST451177 (lexicon) OST449275 (lexicon)
OST443380 (lexicon) OST428426 (lexicon) OST428414 (lexicon) OST414587 (lexicon)
OST403938 (lexicon) OST378969 (lexicon) OST375823 (lexicon) OST355574 (lexicon)
OST334307 (lexicon) OST321602 (lexicon) OST303562 (lexicon) OST301464 (lexicon)
OST300200 (lexicon) OST296475 (lexicon) OST290687 (lexicon) OST285270 (lexicon)
OST282595 (lexicon) OST277031 (lexicon) OST260377 (lexicon) OST236973 (lexicon)
OST232072 (lexicon) OST223207 (lexicon) OST218706 (lexicon) OST217917 (lexicon)
OST213127 (lexicon) OST212259 (lexicon) OST210338 (lexicon) OST205288 (lexicon)
OST205155 (lexicon) OST201231 (lexicon) OST199933 (lexicon) OST196612 (lexicon)
OST194188 (lexicon) OST194141 (lexicon) OST193526 (lexicon) OST191604 (lexicon)
OST188832 (lexicon) OST187572 (lexicon) OST184143 (lexicon) OST180176 (lexicon)
OST180152 (lexicon) OST180134 (lexicon) OST170735 (lexicon) OST168943 (lexicon)
OST168696 (lexicon) OST168203 (lexicon) OST168053 (lexicon) OST136183 (lexicon)
OST131816 (lexicon) OST131566 (lexicon) OST125900 (lexicon) OST118025 (lexicon)
OST112671 (lexicon) OST108253 (lexicon) OST105172 (lexicon) OST100816 (lexicon)
OST99809 (lexicon) OST98856 (lexicon) OST97085 (lexicon) OST96159 (lexicon)
OST77147 (lexicon) OST77014 (lexicon) OST67959 (lexicon) OST64155 (lexicon)
OST63490 (lexicon) OST54631 (lexicon) OST40145 (lexicon) OST38931 (lexicon)
OST38735 (lexicon) OST36418 (lexicon) OST33785 (lexicon) OST33700 (lexicon)
OST32791 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI17790
Vector Insertion
Chr 15: 25705901 - 25706072
Public Clones CMHD-GT_524H8-3 (cmhd) IST14715E11 (tigm)
Private Clones OST436388 (lexicon) OST313703 (lexicon) OST279596 (lexicon) OST269377 (lexicon)
OST240103 (lexicon) OST231862 (lexicon) OST157062 (lexicon) OST98772 (lexicon)
OST44731 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI16738
Vector Insertion
Chr 15: 25706188 - 25707835
Public Clones not available
Private Clones OST455292 (lexicon) OST303673 (lexicon) OST245966 (lexicon) OST243352 (lexicon)
OST232834 (lexicon) OST223715 (lexicon) OST181925 (lexicon) OST156625 (lexicon)
OST82467 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI16280
Vector Insertion
Chr 15: 25707943 - 25709337
Public Clones IST10456H4 (tigm) IST10621E3 (tigm)
Private Clones OST464178 (lexicon) OST234787 (lexicon) OST212282 (lexicon) OST194084 (lexicon)
OST117637 (lexicon) OST113544 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI10963
Vector Insertion
Chr 15: 25709566 - 25710118
Public Clones P097A01 (ggtc) P134A09 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI29499
Vector Insertion
Chr 15: 25710168 - 25710728
Public Clones P134A09 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 8% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI7046
Vector Insertion
Chr 15: 25711620 - 25712672
Public Clones RRY071 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 30% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI1829
Vector Insertion
Chr 15: 25715802 - 25722905
Public Clones BC0223 (sanger) HMA004 (baygenomics) (ggtc) W192C02 (ggtc)
Private Clones OST342311 (lexicon) OST54836 (lexicon)
Severity of mutation (?) Insertion after 40% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI21997
Vector Insertion
Chr 15: 25736933 - 25737490
Public Clones not available
Private Clones OST311819 (lexicon)
Severity of mutation (?) Insertion after 81% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI2764
Vector Insertion
Chr 15: 25740306 - 25741875
Public Clones AK0041 (sanger) XL025 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 98% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000022882




GGAAAGCCAAG - UNI12120 - - UNI12974 - - UNI15056 - - UNI16738 - - UNI17790 - GTCTTCCTTCGAGAATCCTTGGA
























































 - UNI12120 - - UNI12974 - - UNI15056 - - UNI16738 - - UNI17790 - MVIRAHILGYLAR - UNI16280 - RKQYRKV















Transcript ENSMUST00000110450



GCAGCATCTGAAGAGAGGAAAGGGAAAGCCAAG - UNI12120 - - UNI12974 - - UNI15056 - - UNI16738 - - UNI17790 - G











































AASEERKGKAK - UNI12120 - - UNI12974 - - UNI15056 - - UNI16738 - - UNI17790 - VFLRESLEQKLEKRREEEIDRAA















Transcript ENSMUST00000073021





















AACACACAGAAG - UNI3479 - - UNI12120 - - UNI12974 - - UNI15056 - - UNI30739 - ATGCCAGACCAGTTTGATCAGGT




















































I32810 - DSLHSLMATLSSSNPFFVRCIKPNTQK - UNI3479 - - UNI12120 - - UNI12974 - - UNI15056 - - UNI30739 -
















Transcript ENSMUST00000110457


























AACACACAGAAG - UNI3479 - - UNI12120 - - UNI12974 - - UNI15056 - - UNI30739 - ATGCCAGACCAGTTTGATCAGGT



































































TVSSQFK - UNI32810 - DSLHSLMATLSSSNPFFVRCIKPNTQK - UNI3479 - - UNI12120 - - UNI12974 - - UNI15056 - 

















For any suggestions or comments, please send an email to