Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000023156 (Rpp14)
Chromosomal location
Chr 14: 8912881 - 8924350 (+)
Description
ribonuclease P 14 subunit (human) Gene [Source:MGI Symbol;Acc:MGI:1914303]
RefSeq_dna
NM_025938 
RefSeq_peptide
NP_080214.1 
UniGene
Mm.210048 Mm.471756 
MGI
MGI:1914303 
Uniprot/SWISSPROT
Q9CQH8 
Human Ortholog
ENSG00000163684 (RPP14)
Omim not available
UniTrap UNI22412
Vector Insertion
Chr 14: 8913027 - 8916221
Public Clones (sanger) D148H12 (ggtc) D146A10 (ggtc) D148A10 (ggtc) IST14910H2 (tigm)
IST14356D2 (tigm) IST10068G3 (tigm) IST10931E11 (tigm)
Private Clones OST297798 (lexicon) OST185541 (lexicon) OST119509 (lexicon) OST68223 (lexicon)
OST33766 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI22103
Vector Insertion
Chr 14: 8916309 - 8916430
Public Clones not available
Private Clones OST308459 (lexicon) OST62470 (lexicon)
Severity of mutation (?) Insertion after 19% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI24141
Vector Insertion
Chr 14: 8921312 - 8922421
Public Clones (sanger) IST14466E12 (tigm)
Private Clones OST233086 (lexicon) OST214469 (lexicon)
Severity of mutation (?) Insertion after 85% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000023924
Sequence
ATCACCAGTTTTCCAGGTCCGAACTTGGGCTGCTGCGTGGGAACTCCGACCCATGCCGAATTCTAGCGGCGTGCAAGAGTCAGGAACGCGGTTATTCCAG

TGATCCTCTCCGTCCTGGGCCGAGGCGGTTTAGCCTCGCGGGGCAG - UNI22412 - GTGTCCATGTTGGAAGATGCCAGCGACTGCATATGAAAGA

GTAGTTTACAAGAGCCCCTCAGAGTATCACTACATGAAAGTCTGTCT - UNI22103 - AGAGTTTCAAGAACATGGGGTTGGACTGAACGTGGCACA

GTTCAAACAGCTGCTCGTCTCAGCCCTGAGAGACCTGTTTGGGGAG GTCGGTGCCGCTCTGCCTGTGGATGTTCTCACCTACGATGAGAAGACACTGTC

GGCCATCTTGAGAATATGCAGCAG TGGTCTGGTCAAATTATGGAGTTCTTTGACCTTGTTTGGAGCCTATAAAAGCAAGAAGTGTGCCTTCAGAGTGAT

TCAG - UNI24141 - GTGTCTCCCTTTCTCCTTGCATTATCTGGCAATAGCAGGGAACAAGTATTGGACTGAATACTCTTACAGGTCCAGATACTTC

CACTCTCCACAGTGTCCTTAGGTGTCTACATTATTTGAAAACAGACGAAGGCTAAAGCCCCTGTTGGTGACATTTGGAGATACTGAAGATGTGGCGTGGG

CTTCAGAGGAGACTGTGGCAACATCATGTGGTACCAACAGGGCAGTGTTTTCAGTATGTGCACACGAAAGTTGGAGACCGAGCGGAGCTCAGCAGAGCCT

TCACACAGCAGGATGTAGCTACCTTCTCAGAGTTAACGGGAGATGCCAATCCTTTGCATTTAAGTGAAGATTTTGCAAAACACTCCAAGTTTGGAAAGAC

AATTGTTCACGGAGTTTTGATAAATGGACTTATTTCAGCTCTCCTGGGCACCAAAATGCCAGGGCCAGGCTGTGTGTTTCTTTCCCAGGAAATTAAATTT

CCTGCTCCTCTATATGTTGGAGAGGTGGTCTTAGCATCTGCAGAAGTGAAAAGGCTGAAGCAGTCTGTTGCTGTTGTTGCAGTGTCCTGTTGTGTAATAG

AAAGTAAGAAGACAGTTATGGAAGGCTGGGTTAAAGTTATGGTCCCGGAAGCTCCTAGATCCTGAAATACAAATTTAAAGTTATACATTTAAAAACCTGT

GCTCTTATTATCAAATGACACCCGGGGAGGTGGGCTGCTGCTCTTCCTGGAGGAATGCTGGTATATCCAGAAGCTGTGTGTGGAAGGGGAGACTTCCAGA

TTGGTGCATGGTTTGTCCAGACTTAAATATGTGCAAGATCTCATTGTCTATCAAGGTTTGGATTTTTTTTTTCCAATTAAAAAAACAATTGAGAGGGGCT

GGAGAGATGGCTTATCAGTTAGGATCACTGGCTGCTCTTCCAGAGTATCTGGGTTCAATTCCTAATACCCACATAGCTGCTCACAACTGTATGTAACTTC

AGTCTCAGGTGATCCAACACCATCTTCTGGCCTGTGCCGAAACTACCTGCACATGGTACACAGACATACATGCATACGTGCAAGCAAAATACAAATACAA

TAATAGTAAGATAAAAATCTTTTTAAATTGGGAAGACTATCTTCATGTTTTACTTTCAGAATTTGAAACAGTTATATTTGTATTTGATAACGTCTACGTC

AGTGTTGAGGGATTTTCTTGCTGGATTTATACCACCATGTATACCAAGTGCAGCAATGCAAGTATAACTGCAGCAATGCAAGTAGAGCCATCTCTGAACA

CCTAATTCTGAGACCCTTTCTCAGCGGCTTCTGGGCTAGGCTTATAATTCCTTACACCAAGATGTAATCTTTTGTTGCATGTGGTGCCACTGGCCTTTAG

TTCCCACTTAGGAGGCAGAGGCAGGCAGAATTTAAAGCTAACCTGTGTGCGTAGCAAGTTCTAGAACAGCCAGGGCTACATAAAGAGACCCTGTCAAACC

AATAAAAACAAAAAATGACATTTAATTCAAATTTCTCTGTAACTTGCCTTTCAGGGTTTTGCTGTTACTGGTGAGGGGTTTCCATGCAGCCACGACTCAG

TTATATAAAGTCCTAGCATGGCAGCATTGTTGGAAATAATAGAAACAGAATTCATCAGAGGGCCGGGCCTAGAAATATTAGCCAGTGTTCTCCTTCCATG

TGGCTTCCCATGAGTGAATTGGGTGACTTTTCTGAATTGGAAGTTGGCTGTTCTACATTGATCAGGTTAACATGCTGATCTTTCAGAGAGCTGGCCAATC

TGTTTGTTAGTATTTTAAAACCGAAGGAAAGCATCTGGAATGTAAAGGTGCTGTTTTAAGGGTTCTAATTCTCTCCCGCTCTTGAAAACGTGGATCTACT

TAAAAAAAAAAACAAAAAAAGCAACAACAATAAAACTATTATATGTG
Translation
 - UNI22412 - MPATAYERVVYKSPSEYHYMKVCL - UNI22103 - LEFQEHGVGLNVAQFKQLLVSALRDLFGE VGAALPVDVLTYDEKTLS

AILRICSS SGLVKLWSSLTLFGAYKSKKCAFRVIQ - UNI24141 - VSPFLLALSGNSREQVLD

For any suggestions or comments, please send an email to unitrap@crg.es