Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000024740 (Ddb1)
Chromosomal location
Chr 19: 10680058 - 10704306 (+)
damage specific DNA binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1202384]
Q91YC8 Q3ULS8 
Human Ortholog
ENSG00000167986 (DDB1)
Omim not available
UniTrap UNI1286
Vector Insertion
Chr 19: 10680057 - 10680257
Public Clones DC0525 (sanger) P078D11 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI15489
Vector Insertion
Chr 19: 10680257 - 10681334
Public Clones (ggtc) PST6971-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI37349
Vector Insertion
Chr 19: 10681334 - 10681363
Public Clones (sanger) CMHD-GT_425E8-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI32969
Vector Insertion
Chr 19: 10681484 - 10682282
Public Clones IST15051A6 (tigm) IST10894C7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 6% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI7083
Vector Insertion
Chr 19: 10682963 - 10685191
Public Clones RRJ288 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 16% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI38657
Vector Insertion
Chr 19: 10685307 - 10686133
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 19% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI10341
Vector Insertion
Chr 19: 10688682 - 10689341
Public Clones XA140 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 29% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI14906
Vector Insertion
Chr 19: 10690081 - 10693538
Public Clones PST14618-NL (escells) PST9261-NR (escells) PST9457-NR (escells) PST9836-NR (escells)
PST14618-NR (escells) PST2709-NR (escells) PST2709-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 36% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI3887
Vector Insertion
Chr 19: 10693819 - 10696030
Public Clones AW0151 (sanger) XB204 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 41% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI22784
Vector Insertion
Chr 19: 10703039 - 10703568
Public Clones not available
Private Clones OST284904 (lexicon)
Severity of mutation (?) Insertion after 98% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000025649























































Transcript ENSMUST00000113082


- UNI1286 - - UNI15489 - GACACTTTACTTCAGCGGAAGATCTGAA - UNI3887 - - UNI7083 - - UNI10341 - - UNI1490
































For any suggestions or comments, please send an email to