Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000026696 (Vamp4)
Chromosomal location
Chr 1: 164500859 - 164529209 (+)
Description
vesicle-associated membrane protein 4 Gene [Source:MGI Symbol;Acc:MGI:1858730]
RefSeq_dna
NM_016796 
RefSeq_peptide
NP_058076.2 
UniGene
Mm.10699 Mm.411120 
MGI
MGI:1858730 
Uniprot/SWISSPROT
O70480 
Uniprot/SPTREMBL
Q8BSN6 
Human Ortholog
ENSG00000117533 (VAMP4)
Omim not available
UniTrap UNI18344
Vector Insertion
Chr 1: 164504429 - 164504548
Public Clones not available
Private Clones OST425221 (lexicon) OST404808 (lexicon) OST260940 (lexicon) OST250829 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI7002
Vector Insertion
Chr 1: 164508050 - 164511949
Public Clones RRZ254 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 26% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000111573
Sequence
CTGCCCTGCGCTGCCAGCAGGGACTGCTGCCGGGAGCCCATCGGAGACCGCAG - UNI18344 - TGGTGAATTCTTACTCTGTTGGGAAACACAGGA

ACATTTGTGAGCAGGAAGTATGCCTCCCAAGTTCAAGCGCCACCTAAATGATGATGACGTGACCGGGTCTGTGAAAAGTGAGAGG - UNI18344 - A

GAAATCTTTTGGAAGATGATTCAGATGAAGAAGAGGACTTTTTTCT - UNI7002 - ACGGGGACCATCTGGACCAAGATTTGGACCTAGAAATGATA

AAATTAAGCA TGTTCAGAATCAGGTGGATGAAGTTATTGATGTAATGCAAGAGAATATTACAAAGGTAATTGAAAGAGGAGAGAGGCTGGATGAACTAC

AGGACAAATCAG AAAGCTTATCGGATAATGCCACCGCTTTCAGCAACAGATCCAAACAGCTTCGAAGGCAAATGTGGTGGCGTGGATGCAAA ATAAAA

GCCATCATGGCTTTGGCTGCAGCGATCCTTTTGCTAATGATTATCA CTCAGATCATCCTGCACTTGAAAAAATGA
Translation
 - UNI18344 - MPPKFKRHLNDDDVTGSVKSER - UNI18344 - RNLLEDDSDEEEDFFL - UNI7002 - LRGPSGPRFGPRNDKIKH HV

QNQVDEVIDVMQENITKVIERGERLDELQDKSE ESLSDNATAFSNRSKQLRRQMWWRGCK IKAIMALAAAILLLMIIT TQIILHLKK
Transcript ENSMUST00000050010
Sequence
CCTGCCTACCGCCCCCAACGTCCGCTGGGGCTGGGAACCGGCCTGCGCGAGG GTGGTGAATTCTTACTCTGTTGGGAAACACAGGAACATTTGTGAGCA

GGAAGTATGCCTCCCAAGTTCAAGCGCCACCTAAATGATGATGACGTGACCGGGTCTGTGAAAAGTGAGAGG - UNI18344 - AGAAATCTTTTGGA

AGATGATTCAGATGAAGAAGAGGACTTTTTTCT - UNI7002 - ACGGGGACCATCTGGACCAAGATTTGGACCTAGAAATGATAAAATTAAGCA TG

TTCAGAATCAGGTGGATGAAGTTATTGATGTAATGCAAGAGAATATTACAAAGGTAATTGAAAGAGGAGAGAGGCTGGATGAACTACAGGACAAATCAG 

AAAGCTTATCGGATAATGCCACCGCTTTCAGCAACAGATCCAAACAGCTTCGAAGGCAAATGTGGTGGCGTGGATGCAAA ATAAAAGCCATCATGGCTT

TGGCTGCAGCGATCCTTTTGCTAATGATTATCA CTCAGATCATCCTGCACTTGAAAAAATGAAGTTTTACCACCATCAAAACTATCACTATTTAACAAC

AGTGAAGATCAACAGAAAAATTCAAGTAGCTTTGCTAATGTTAGTTGATGCCCAGTGAAATCAGGTCACCACTGCCGTGCCTGATGCGTGCCCCTGTGGT

TTTTCTGTAACAGAAGCCTCTCCCTTGCAGCAGTTTGTGATGAATGGGTTCCTCCTCCATCATAACCCAGTGTTAGTGTTGCCTGTGGTCTTTTTATTCC

TTTGTCCTAACAAAACTCATTGGGAAATGTCCCAAAAGTTTATAAGCTGGGAAATTTATTGATTAAGAGAAGGTCCAGTGCTGATGATGGAACATTGTTT

AAAATGGAGAAAGGGTAGCACACATCAGTTGCAGAGGTGCCTGTGATGGGGTTCCTGTAGACTCTCATTACAGTCCACTCTGGGTTCTGTGTTAGAAAGT

AATGCCATTCTGATAGCAGCAACCGGCACCTTTCTGTTCTGTATGGCATGTGGGTGCCCTCAGATGTGATAAGAGCCTGACCTCTGTCCTTGTCACTTAA

CACCTGTTCTGTGTGCTGTCGGCACTGTAGACCAAACAGACTTGTATTTACATCTCATAGATATTTTATGGCTAGAAAATATGCAAGAAGTTTTTTTAGT

GTTGAAAACAAATGTCATTATATGTTCTTAGTTGTATTGAGTCAGAGTGTTACGAAGTTAGGAACTGGACTACTAATCAGATTTTGTGTTTTCTCACAGA

AATGTTATCAGAGTCACTTTTACTTCTCTGTGAGTGATAGTAAGAGCATGACTCAGTCTAAACACATGAAGGTGGGGGTTGTCAAATAACAGCAGAAAGG

CAGTGGCTCAGAAGACACAGAAAGGGGCCATCTTAGTCCATACAAATGTGCCTTCCCTTAGACTGACAGGGTCTGAGTTTATCTTGTATGTCTTGGTTCT

TTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTTTATTTGGTTTTGGTTTTGGCTTTAGTTTTGTTTGTTTGTTTGTTTGTTTGGATTTTTTTTGTTT

TTTTTTTGAGATACGGTCTTACTGTGTGACCCAGACTGACCTCAGATGCACACAGAGCCATCAGCCTCCCACATGCTGGGATTAGAGGTATGTGCCACCA

CACCCTTCAGCCCTTTTCTTTTTGATCAAAGAATTCCTGGGCTCAAGTTATCTTTCCAGCTTAGCCTCAGAAGTAGCTACAACTACATGTGGGCGCCAGC

TTGGGCAGGTGAGCCTTTTCTTTAAGCCTGATGTTAGTCTCACTTGGATATTTACCTTCTTATGTCAAGCAGAATAAGGGTGGAACACGCTTTTCTTCTG

GCTCTTGTTTATTTTACAAGGCTACTTAGGTTAGCAGGGATGGGAAGAAAAACATTGCTAATCCAGTTGGGATAAACGTACGTTTGAGCTTATAAAGCAA

GGACCACACCACGTTGTGTCTCTCAGCTGCAATCCCTGTGTGTATGGCTGTGCCCCAGAAGTCACACCATGCTGGTGGTGAATAAGTGAGGGCTGATTTC

CAGTGTGTGCCAAGAAGTAACATGATTGAGGTAGGTGAACCTAGAGATAAAAGAGTTCTTATGATTTAGTATTGAAAAAATTCTGGTTTTACGATGTTGC

ATTTGATTCTTTTCACTTGAAAAGTCATGTTTTAAAGCTGTAAATTGCCTATGTCTAAGGATTTAGTAAAATGTCAGAGATCAATCTATAAGAAAATTCA

AACATTGTTTTTATATCTTAGTAGTATGTCATTATTTTAGACCTCACAATCCCTAATTTAACCATTTCGGCAAGTGCCTTTGACACATACGGAGTATTAT

GGGAGATGAGCAAATGTAGTGCCACACCCCGTTTCCCGGCTTCTCAATGCCTCGTGATGGTATATGTTTAACAGTGCTGCACAGTTCAGTTCTTTGTGTT

CATACGAGATTGTATTGTAGCCTTTCCATAGCAAACAGCAAAATAAACCATTTTGCAGAAAATG
Translation
 MPPKFKRHLNDDDVTGSVKSER - UNI18344 - RNLLEDDSDEEEDFFL - UNI7002 - LRGPSGPRFGPRNDKIKH HVQNQVDEVIDVMQE

NITKVIERGERLDELQDKSE ESLSDNATAFSNRSKQLRRQMWWRGCK IKAIMALAAAILLLMIIT TQIILHLKK
Transcript ENSMUST00000086068
Sequence
CTGCCCTGCGCTGCCAGCAGGGACTGCTGCCGGGAGCCCATCGGAGACCGCAG - UNI18344 - TGGTGAATTCTTACTCTGTTGGGAAACACAGGA

ACATTTGTGAGCAGGAAGTATGCCTCCCAAGTTCAAGCGCCACCTAAATGATGATGACGTGACCGGGTCTGTGAAAAGTGAGAGG - UNI18344 - A

GAAATCTTTTGGAAGATGATTCAGATGAAGAAGAGGACTTTTTTCT - UNI7002 - ACGGGGACCATCTGGACCAAGATTTGGACCTAGAAATGATA

AAATTAAGCA TGTTCAGAATCAGGTGGATGAAGTTATTGATGTAATGCAAGAGAATATTACAAAGGTAATTGAAAGAGGAGAGAGGCTGGATGAACTAC

AGGACAAATCAG AAAGCTTATCGGATAATGCCACCGCTTTCAGCAACAGATCCAAACAGCTTCGAAGGCAAATGTGGTGGCGTGGATGCAAA ATAAAA

GCCATCATGGCTTTGGCTGCAGCGATCCTTTTGCTAATGATTATCA TTCTTATAGTTGTGAAATTCCGTACTTGATTTGATGACAGAGACCCTCATTAA

ACAAGATCTGGGACAATAATATTTAAAGATTGCTGCATAATGTAAATGAAACCTATGTATAGAACTTTCAAATTTCCTTTTTCAAGAAACTAAAAGGCAA

GTACCAATTCAAATTGGAGCATTGAGAATATCGAATGATCACCTTTCCAACTAACAAAATGCATTTTGAATAATTATATTTGATGTAGAAATATCTCTAT

TTTGCTTTATTCCAAGGATCTAATTTGAAACTAGATACTTGCCAGTCTGTTATTTGTATATATAGTTGAACCCTGATAACAATGCCCCATACTTGTGTTT

CAGTTGCATTAAAGACATTATTGCATCTAAGTGAGAGTCAGTCTGGTGACCAGGAAGCCTATGTAGAGTCCTGACTCTTTGCTGCAAGAGATGCATAACC

ATCCTATCAGTATTTGCAAGAATGCCATTCTTTTCATATTGTAGTTGCTTTGCAGGCAATTTCCACACTTATGGATTAACAAAAGCTAAGTGTTGTAAAT

GTTTCTGCCTTCAGCTCTACCCGAAAACATTCCAGTAAACCTATTCTGACTGT
Translation
 - UNI18344 - MPPKFKRHLNDDDVTGSVKSER - UNI18344 - RNLLEDDSDEEEDFFL - UNI7002 - LRGPSGPRFGPRNDKIKH HV

QNQVDEVIDVMQENITKVIERGERLDELQDKSE ESLSDNATAFSNRSKQLRRQMWWRGCK IKAIMALAAAILLLMIII ILIVVKFRT

For any suggestions or comments, please send an email to unitrap@crg.es