Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000027547 (Sall4)
Chromosomal location
Chr 2: 168573832 - 168592701 (-)
sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]
NM_201396 NM_175303 NM_201395 
NP_958798.2 NP_780512.2 NP_958797.2 
Mm.474972 Mm.434054 
Human Ortholog
ENSG00000101115 (SALL4)
UniTrap UNI1046
Vector Insertion
Chr 2: 168592411 - 168592702
Public Clones AY0315 (sanger) AL0112 (sanger) XP0598 (sanger) RRR048 (baygenomics)
CSH906 (baygenomics) XK506 (baygenomics) CSA015 (baygenomics) RRP015 (baygenomics)
YHD033 (baygenomics) RRT176 (baygenomics) RRK077 (baygenomics) YHD034 (baygenomics)
M120F09 (ggtc) P064E04 (ggtc) W188D04 (ggtc) M076F06 (ggtc) P006A10 (ggtc)
M081F07 (ggtc) P024E09 (ggtc) W215B03 (ggtc) P066G10 (ggtc) P017C06 (ggtc)
M080A04 (ggtc) P126F07 (ggtc) M123A11 (ggtc) P017E06 (ggtc) M076F05 (ggtc)
P024B05 (ggtc) W231C05 (ggtc) D042A03 (ggtc) Q012C04 (ggtc) P137H07 (ggtc)
M123A02 (ggtc) W261E05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI19615
Vector Insertion
Chr 2: 168592411 - 168592702
Public Clones not available
Private Clones OST386061 (lexicon) OST376345 (lexicon) OST354908 (lexicon) OST347325 (lexicon)
OST325009 (lexicon) OST293168 (lexicon) OST287549 (lexicon) OST266063 (lexicon)
OST134445 (lexicon) OST128657 (lexicon) OST105027 (lexicon) OST81054 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI30150
Vector Insertion
Chr 2: 168590593 - 168592702
Public Clones (sanger) D101E06 (ggtc) D030H04 (ggtc) IST14578B7 (tigm) IST12509C5 (tigm)
IST14125H8 (tigm) IST12859H2 (tigm) IST11051F8 (tigm) IST13664F5 (tigm)
IST10893A5 (tigm) IST11151H9 (tigm) IST14190H6 (tigm) IST12466H6 (tigm)
IST15057B9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 14% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI4185
Vector Insertion
Chr 2: 168582301 - 168590593
Public Clones (sanger) AM0297 (sanger) D170D03 (ggtc) D042A06 (ggtc) 5SP137H07 (ggtc)
P126F07 (ggtc) D143D04 (ggtc) D025E05 (ggtc) 5SP102G07 (ggtc) P117F07 (ggtc)
D045F03 (ggtc) D018H02 (ggtc) P136F02 (ggtc) 5SD004B11 (ggtc) P126A11 (ggtc)
D104C05 (ggtc) 5SD138B12 (ggtc) E129C02 (ggtc) D016G07 (ggtc) D042A03 (ggtc)
3SD004B11 (ggtc) D062C01 (ggtc) D019A02 (ggtc) 3SD138B12 (ggtc) CMHD-GT_516F2-5S (cmhd)
PST22862-NR (escells) PST16261-NR (escells) PST24119-NR (escells) IST10945D7 (tigm)
IST14116D9 (tigm) IST10034C10 (tigm) IST10065A5 (tigm) IST10115D6 (tigm)
IST13192A2 (tigm) IST14560H3 (tigm) IST14378G3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 14% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI4890
Vector Insertion
Chr 2: 168581265 - 168582301
Public Clones AT0337 (sanger) RRC044 (baygenomics) XE027 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 14% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI5565
Vector Insertion
Chr 2: 168579933 - 168580630
Public Clones YTA244 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 14% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI16162
Vector Insertion
Chr 2: 168579933 - 168582301
Public Clones CMHD-GT_418D1-3 (cmhd) CMHD-GT_462F3-3 (cmhd) CMHD-GT_485D9-3 (cmhd) CMHD-GT_474A9-3 (cmhd)
Private Clones OST465848 (lexicon) OST413085 (lexicon) OST358118 (lexicon) OST318078 (lexicon)
OST307292 (lexicon) OST299732 (lexicon) OST245808 (lexicon) OST208005 (lexicon)
OST178544 (lexicon) OST167051 (lexicon) OST141309 (lexicon) OST108533 (lexicon)
OST102964 (lexicon) OST77162 (lexicon) OST47816 (lexicon)
Severity of mutation (?) Insertion after 14% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI10349
Vector Insertion
Chr 2: 168577953 - 168578241
Public Clones XA246 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 14% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI27638
Vector Insertion
Chr 2: 168575961 - 168577953
Public Clones not available
Private Clones OST54922 (lexicon)
Severity of mutation (?) Insertion after 49% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI10376
Vector Insertion
Chr 2: 168575961 - 168577953
Public Clones XB341 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 49% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000075044



 - - UNI4185 - - UNI4890 - - UNI5565 - - UNI10349 - - UNI16162 - - UNI19615 - - UNI30150 - GTCGTACCA





























Transcript ENSMUST00000029061



 - - UNI4185 - - UNI4890 - - UNI16162 - - UNI19615 - - UNI30150 - GTGCTCCAGTGAACTCCCCTGGGAACTGCGATGA





























































Transcript ENSMUST00000103074



 - - UNI4185 - - UNI4890 - - UNI16162 - - UNI19615 - - UNI30150 - GTGCTCCAGTGAACTCCCCTGGGAACTGCGATGA











































Transcript ENSMUST00000109168



 - - UNI4185 - - UNI4890 - - UNI16162 - - UNI19615 - - UNI30150 - GTGCTCCAGTGAACTCCCCTGGGAACTGCGATGA













 - UNI1046 - - UNI4185 - - UNI4890 - - UNI16162 - - UNI19615 - - UNI30150 - MWAAHALHSGVAGADTLKALSSHV



Transcript ENSMUST00000109167





































162 -  - UNI10349 - - UNI10376 - - UNI27638 - 

For any suggestions or comments, please send an email to