Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000028126 (Pip5k1a)
Chromosomal location
Chr 3: 94862452 - 94910797 (-)
phosphatidylinositol-4-phosphate 5-kinase, type 1 alpha Gene [Source:MGI (curated);Acc:Pip5k1a-002]
Mm.402240 Mm.296409 
Human Ortholog
ENSG00000180764 (PIPSL)
Omim not available
UniTrap UNI16381
Vector Insertion
Chr 3: 94910297 - 94910746
Public Clones not available
Private Clones OST461947 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI5111
Vector Insertion
Chr 3: 94910297 - 94910702
Public Clones RRA016 (baygenomics) YTC250 (baygenomics) RRI246 (baygenomics) CSI224 (baygenomics)
XE248 (baygenomics) CSI256 (baygenomics) A049A01 (ggtc) A026B08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI14772
Vector Insertion
Chr 3: 94900964 - 94910702
Public Clones (ggtc) PST15132-NL (escells) PST11211-NR (escells) IST12065H10 (tigm)
Private Clones OST426918 (lexicon) OST336333 (lexicon) OST187383 (lexicon) OST107166 (lexicon)
OST71904 (lexicon) OST59844 (lexicon) OST42174 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI33559
Vector Insertion
Chr 3: 94886712 - 94901241
Public Clones IST14857G4 (tigm) IST10077C2 (tigm) IST13948G10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI7094
Vector Insertion
Chr 3: 94886712 - 94886745
Public Clones RRI243 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI18295
Vector Insertion
Chr 3: 94882105 - 94882411
Public Clones not available
Private Clones OST426235 (lexicon) OST159978 (lexicon) OST43713 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI8229
Vector Insertion
Chr 3: 94878046 - 94882023
Public Clones RRF197 (baygenomics)
Private Clones OST249467 (lexicon)
Severity of mutation (?) Insertion after 17% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI8058
Vector Insertion
Chr 3: 94874934 - 94875811
Public Clones RRJ208 (baygenomics) RRJ209 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 36% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI12515
Vector Insertion
Chr 3: 94871388 - 94871982
Public Clones W167A06 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 67% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI932
Vector Insertion
Chr 3: 94869783 - 94871303
Public Clones BC0169 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 72% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI448
Vector Insertion
Chr 3: 94869342 - 94869366
Public Clones DC0148 (sanger) CSD327 (baygenomics) HMA542 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 67% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI14950
Vector Insertion
Chr 3: 94868252 - 94869366
Public Clones PST6986-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 69% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI10829
Vector Insertion
Chr 3: 94864452 - 94867576
Public Clones D031C08 (ggtc)
Private Clones OST67786 (lexicon) OST67764 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000107229








Transcript ENSMUST00000107231








Transcript ENSMUST00000005768











































Transcript ENSMUST00000107232










































Transcript ENSMUST00000107233





 - UNI5111 - - UNI14772 - - UNI16381 - - UNI33559 - CAGCATCTGGAATCAAGAGAGCCACAGTATCTGAG - UNI7094 - 








































Transcript ENSMUST00000107235





 - UNI5111 - - UNI14772 - - UNI16381 - - UNI33559 - CAGCATCTGGAATCAAGAGAGCCACAGTATCTGAG - UNI7094 - 
































Transcript ENSMUST00000107236













































For any suggestions or comments, please send an email to