Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000028568 (Btf3l4)
Chromosomal location
Chr 4: 108489055 - 108506219 (-)
basic transcription factor 3-like 4 Gene [Source:MGI (curated);Acc:Btf3l4-001]
A2A7Z4 Q78IG7 
Human Ortholog
ENSG00000134717 (BTF3L4)
Omim not available
UniTrap UNI6211
Vector Insertion
Chr 4: 108506112 - 108506170
Public Clones CSG280 (baygenomics) Q012E01 (ggtc) P147G04 (ggtc) P027A10 (ggtc)
H003A03 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI30278
Vector Insertion
Chr 4: 108505017 - 108506160
Public Clones (sanger) D024E08 (ggtc) D031C06 (ggtc) D024C09 (ggtc) D048D07 (ggtc)
D024F08 (ggtc) IST10834B3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI15729
Vector Insertion
Chr 4: 108504310 - 108505057
Public Clones (sanger) E058G09 (ggtc) PST1685-1 (escells)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI21895
Vector Insertion
Chr 4: 108503122 - 108503189
Public Clones not available
Private Clones OST314605 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI30269
Vector Insertion
Chr 4: 108503122 - 108504537
Public Clones D052C09 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI16181
Vector Insertion
Chr 4: 108498819 - 108503122
Public Clones not available
Private Clones OST465545 (lexicon) OST429713 (lexicon) OST407670 (lexicon) OST395426 (lexicon)
OST293266 (lexicon) OST289918 (lexicon) OST268687 (lexicon) OST267415 (lexicon)
OST223785 (lexicon) OST215873 (lexicon) OST206615 (lexicon) OST183129 (lexicon)
OST150995 (lexicon) OST128995 (lexicon) OST122366 (lexicon) OST122346 (lexicon)
OST115614 (lexicon) OST98980 (lexicon) OST85691 (lexicon) OST83584 (lexicon)
OST65601 (lexicon) OST45595 (lexicon) OST44646 (lexicon) OST40616 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI24237
Vector Insertion
Chr 4: 108491943 - 108498704
Public Clones (sanger)
Private Clones OST230279 (lexicon) OST203308 (lexicon) OST136551 (lexicon) OST122413 (lexicon)
OST122411 (lexicon) OST122297 (lexicon) OST78857 (lexicon) OST75019 (lexicon)
OST36108 (lexicon) OST21935 (lexicon)
Severity of mutation (?) Insertion after 35% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI22159
Vector Insertion
Chr 4: 108490850 - 108491740
Public Clones not available
Private Clones OST305649 (lexicon) OST301996 (lexicon)
Severity of mutation (?) Insertion after 78% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI15430
Vector Insertion
Chr 4: 108489054 - 108490850
Public Clones PST6781-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 91% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000102739








 - UNI15729 - - UNI21895 - - UNI30269 - MNQEKLAKLQAQVRIGGK - UNI16181 - - UNI21895 - - UNI30269 - GT


Transcript ENSMUST00000102740








 - UNI6211 - - UNI15729 - - UNI30278 -  - UNI15729 - - UNI21895 - - UNI30269 - - UNI30278 - MNQEKLAK



Transcript ENSMUST00000102741











 - UNI15729 - - UNI21895 - - UNI30269 - - UNI30278 - MNQEKLAKLQAQVRIGGK - UNI16181 - - UNI21895 - - 



Transcript ENSMUST00000102742

GCTGCAG - UNI6211 - - UNI15729 - - UNI21895 - - UNI30269 - - UNI30278 - ATTTGCAACAGCATGAATCAAGAAAAGT










 - UNI6211 - - UNI15729 - - UNI21895 - - UNI30269 - - UNI30278 - MNQEKLAKLQAQVRIGGK - UNI16181 - - U




For any suggestions or comments, please send an email to