Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000029267 (Mtf2)
Chromosomal location
Chr 5: 108494732 - 108538023 (+)
metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]
Mm.257149 Mm.448552 
Q924U2 Q05C61 
Human Ortholog
ENSG00000143033 (MTF2)
Omim not available
UniTrap UNI796
Vector Insertion
Chr 5: 108494760 - 108494985
Public Clones CJ0713 (sanger) CH0293 (sanger) XG745 (baygenomics) XC348 (baygenomics)
(ggtc) P140E03 (ggtc) W207C06 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI15818
Vector Insertion
Chr 5: 108494985 - 108498180
Public Clones (sanger) 5SP136E11 (ggtc) 3SP104C05 (ggtc) 3SP136E11 (ggtc) 3SD138D11 (ggtc)
5SE063F06 (ggtc) 3SP104C06 (ggtc) IST14165G5 (tigm) IST12043F9 (tigm)
IST11993G7 (tigm) IST14169G5 (tigm)
Private Clones OST472520 (lexicon) OST465944 (lexicon) OST422884 (lexicon) OST414376 (lexicon)
OST391250 (lexicon) OST377148 (lexicon) OST371870 (lexicon) OST341346 (lexicon)
OST304357 (lexicon) OST267414 (lexicon) OST154438 (lexicon) OST81875 (lexicon)
OST63486 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI4551
Vector Insertion
Chr 5: 108494985 - 108498180
Public Clones AG0200 (sanger) RRD161 (baygenomics) P028F09 (ggtc) W253F07 (ggtc)
P025D01 (ggtc) P008B09 (ggtc) G039E06 (ggtc) M013E08 (ggtc) P007F09 (ggtc)
D037E10 (ggtc) P017H02 (ggtc) P063G07 (ggtc) M016B07 (ggtc) P012B03 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI14993
Vector Insertion
Chr 5: 108498543 - 108509843
Public Clones (sanger) 5SE289E02 (ggtc) 5SP147A09 (ggtc) 5SP139H05 (ggtc) 5SD046H02 (ggtc)
5SD041C05 (ggtc) 3SD038B11 (ggtc) 5SD031F06 (ggtc) 3SE061B12 (ggtc)
3SD028A12 (ggtc) 3SD015B04 (ggtc) 5SP134B12 (ggtc) 5SP132C02 (ggtc)
5SP128D10 (ggtc) 5SP119D03 (ggtc) 5SP117D10 (ggtc) 3SP107C09 (ggtc)
3SP105F01 (ggtc) 5SD147F02 (ggtc) 3SP151D10 (ggtc) 5SP143D06 (ggtc)
5SP137F08 (ggtc) 3SD045F05 (ggtc) 5SE121C07 (ggtc) 3SD037F11 (ggtc)
3SE079A03 (ggtc) 3SD029D09 (ggtc) 3SD020B06 (ggtc) 3SP135A04 (ggtc)
3SD002B04 (ggtc) 3SP132B03 (ggtc) 5SP121A09 (ggtc) 5SP117H08 (ggtc)
5SP116C03 (ggtc) 5SP106H12 (ggtc) 5SP099H05 (ggtc) 5SH004C10 (ggtc)
D044F04 (ggtc) 5SP148D06 (ggtc) 3SP140E03 (ggtc) 5SE125F04 (ggtc)
5SD042A08 (ggtc) 5SD039F06 (ggtc) 5SD035F08 (ggtc) 3SE068H06 (ggtc)
5SD028C08 (ggtc) 3SE038B11 (ggtc) 5SP134F10 (ggtc) 5SP133D04 (ggtc)
5SP131A04 (ggtc) 5SD171H11 (ggtc) 5SP117D11 (ggtc) 5SP107F02 (ggtc)
5SP106D05 (ggtc) 5SP097G12 (ggtc) 3SD138B01 (ggtc) 3SE289E02 (ggtc)
3SP143F10 (ggtc) 3SP139H05 (ggtc) 3SD046H02 (ggtc) 3SD041C05 (ggtc)
5SD038B09 (ggtc) 3SD031F06 (ggtc) 3SE049H04 (ggtc) 5SD024H03 (ggtc)
3SP137B06 (ggtc) 3SP134B12 (ggtc) 3SP132C02 (ggtc) 3SP125F04 (ggtc)
5SD170C06 (ggtc) 3SP117D10 (ggtc) 5SP107C01 (ggtc) 5SP103A05 (ggtc)
5SD144D04 (ggtc) 3SP151C11 (ggtc) 3SP143D06 (ggtc) 5SE126C08 (ggtc)
5SD044A09 (ggtc) 5SD040E07 (ggtc) 5SD037F10 (ggtc) 5SE069F02 (ggtc)
5SD028F04 (ggtc) 5SD017H01 (ggtc) 5SP134H12 (ggtc) 5SP133E10 (ggtc)
5SP131B07 (ggtc) 3SP121A09 (ggtc) 3SP117H08 (ggtc) 3SP116C03 (ggtc)
5SP106E10 (ggtc) 3SP099H05 (ggtc) 5SH003E06 (ggtc) 3SP148D06 (ggtc)
3SP140C08 (ggtc) 5SE125F03 (ggtc) 3SD042A08 (ggtc) 3SD039F06 (ggtc)
3SD035F08 (ggtc) 5SE061B12 (ggtc) 3SD028C08 (ggtc) 5SD015B04 (ggtc)
3SP134F10 (ggtc) 5SP133A01 (ggtc) 3SP131A04 (ggtc) 3SD171H11 (ggtc)
3SP117D11 (ggtc) 3SP107F02 (ggtc) 3SP106D05 (ggtc) 3SP097G12 (ggtc)
5SD127D11 (ggtc) 5SP151D10 (ggtc) 3SP143E10 (ggtc) 5SP138C03 (ggtc)
5SD045F05 (ggtc) 5SD040G11 (ggtc) 3SD038B09 (ggtc) 3SE080F09 (ggtc)
3SD029D10 (ggtc) 5SD024C04 (ggtc) 3SE021G08 (ggtc) 5SD002B04 (ggtc)
5SP132B03 (ggtc) 5SP122F07 (ggtc) 5SP118A09 (ggtc) 5SP116H08 (ggtc)
3SP107C01 (ggtc) 3SP102B06 (ggtc) 5SH007G03 (ggtc) P095H07 (ggtc)
5SP149D10 (ggtc) 5SP140E03 (ggtc) 3SE126C08 (ggtc) 3SD044A09 (ggtc)
3SD040E07 (ggtc) 3SD037F10 (ggtc) 5SE068H06 (ggtc) 3SD028F04 (ggtc)
3SE039F04 (ggtc) 3SP134H12 (ggtc) 3SP133E10 (ggtc) 3SP131B07 (ggtc)
5SP120H12 (ggtc) 5SP117G02 (ggtc) 3SD162G03 (ggtc) 3SP106E10 (ggtc)
3SP099C05 (ggtc) 5SD138B01 (ggtc) PST14207-NL (escells) PST8162-NR (escells)
PST8271-NR (escells) PST5853-NL (escells) PST24749-NR (escells) PST19477-NR (escells)
PST11801-NR (escells) PST8935-NR (escells) PST2286-NR (escells) PST23699-NR (escells)
PST14441-NL (escells) PST8628-NR (escells) PST7906-NR (escells) PST3977-NL (escells)
PST21517-NR (escells) PST13841-NR (escells) PST8380-NL (escells) PST6541-NR (escells)
PST1015-1 (escells) PST21460-NL (escells) PST17271-NR (escells) PST10557-NR (escells)
PST8846-NR (escells) PST2990-NR (escells) PST22910-NR (escells) PST14424-NR (escells)
PST911-1 (escells) PST7554-NR (escells) PST5600-NR (escells) PST19831-NR (escells)
PST12002-NR (escells) PST9427-NR (escells) PST8332-NR (escells) PST199-1 (escells)
PST20461-NL (escells) PST5914-NR (escells) PST10946-NR (escells) PST8022-NR (escells)
PST3985-NL (escells) PST20336-NR (escells) PSTVU01.H14D (vanderbilt) PSTVU01.E7M (vanderbilt)
IST14466A12 (tigm) IST14318B1 (tigm) IST11803C1 (tigm) IST15036F4 (tigm)
IST15067D5 (tigm) IST14502H6 (tigm) IST14415G12 (tigm) IST14273E8 (tigm)
IST15009G8 (tigm) IST14180E1 (tigm) IST11695H5 (tigm) IST14403A11 (tigm)
IST10104A4 (tigm) IST12681G8 (tigm) IST14633C10 (tigm) IST13030B9 (tigm)
IST12300B4 (tigm) IST14371D6 (tigm) IST10691A11 (tigm) IST14696G2 (tigm)
IST14560A11 (tigm) IST14678E12 (tigm) IST11784B8 (tigm) IST10115E6 (tigm)
IST15004C4 (tigm) IST14523F10 (tigm) IST14356G5 (tigm) IST14871C8 (tigm)
IST14649A6 (tigm) IST11616C9 (tigm) IST14496B2 (tigm) IST14373D11 (tigm)
IST10931C9 (tigm) IST14583C12 (tigm) IST14383H2 (tigm) IST15049D3 (tigm)
IST14280C2 (tigm) IST14629B7 (tigm) IST15002C1 (tigm) IST14378B3 (tigm)
IST14635B7 (tigm) IST14640B2 (tigm) IST14376A12 (tigm) IST11742C1 (tigm)
IST14209B12 (tigm) IST13609B10 (tigm) IST11201A11 (tigm) IST11615E10 (tigm)
IST13066B5 (tigm) IST15049E1 (tigm) IST11581B8 (tigm) IST10901B3 (tigm)
IST14148C8 (tigm) IST14823C3 (tigm) IST14633B11 (tigm) IST11465A9 (tigm)
IST14924C11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI11062
Vector Insertion
Chr 5: 108498543 - 108509843
Public Clones M046F03 (ggtc) P032B09 (ggtc) CMHD-GT_327C2-3 (cmhd) CMHD-GT_339B10-3 (cmhd)
FHCRC-GT-S20-6B1 (fhcrc) PST1067-2 (escells) PST12567-NR (escells) PST2934-NR (escells)
PST2934-NL (escells) PST12208-NR (escells) PST8628-NL (escells) PST1067-1 (escells)
PST14441-NR (escells) PST2575-NR (escells) PST2575-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI10939
Vector Insertion
Chr 5: 108509843 - 108510043
Public Clones M039B06 (ggtc) M004B04 (ggtc) M005D03 (ggtc) P084B04 (ggtc) D015E08 (ggtc)
CMHD-GT_483G5-3 (cmhd)
Private Clones OST453752 (lexicon) OST447669 (lexicon) OST445623 (lexicon) OST435428 (lexicon)
OST435098 (lexicon) OST431036 (lexicon) OST429884 (lexicon) OST379502 (lexicon)
OST376644 (lexicon) OST364117 (lexicon) OST360064 (lexicon) OST358295 (lexicon)
OST334025 (lexicon) OST325463 (lexicon) OST323212 (lexicon) OST320487 (lexicon)
OST318931 (lexicon) OST315895 (lexicon) OST315284 (lexicon) OST303357 (lexicon)
OST303190 (lexicon) OST301607 (lexicon) OST297127 (lexicon) OST295616 (lexicon)
OST291989 (lexicon) OST284512 (lexicon) OST281685 (lexicon) OST281432 (lexicon)
OST276772 (lexicon) OST261456 (lexicon) OST257117 (lexicon) OST248280 (lexicon)
OST245794 (lexicon) OST244596 (lexicon) OST232310 (lexicon) OST219434 (lexicon)
OST215540 (lexicon) OST209709 (lexicon) OST207104 (lexicon) OST206610 (lexicon)
OST206357 (lexicon) OST199707 (lexicon) OST198782 (lexicon) OST198440 (lexicon)
OST189322 (lexicon) OST185651 (lexicon) OST167893 (lexicon) OST167379 (lexicon)
OST167209 (lexicon) OST150866 (lexicon) OST139905 (lexicon) OST134606 (lexicon)
OST132162 (lexicon) OST129713 (lexicon) OST129617 (lexicon) OST127867 (lexicon)
OST114901 (lexicon) OST114757 (lexicon) OST105145 (lexicon) OST100857 (lexicon)
OST91066 (lexicon) OST90788 (lexicon) OST83577 (lexicon) OST80959 (lexicon)
OST79146 (lexicon) OST68694 (lexicon) OST68457 (lexicon) OST45313 (lexicon)
OST43114 (lexicon) OST34758 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI14881
Vector Insertion
Chr 5: 108510043 - 108510155
Public Clones PST5679-NL (escells) PST4564-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI17974
Vector Insertion
Chr 5: 108510043 - 108510155
Public Clones (sanger) P095H07 (ggtc) D018A09 (ggtc) P135G08 (ggtc) E066F08 (ggtc)
D015E08 (ggtc) IST14387H10 (tigm)
Private Clones OST432618 (lexicon) OST390428 (lexicon) OST315853 (lexicon) OST308148 (lexicon)
OST306901 (lexicon) OST289656 (lexicon) OST284137 (lexicon) OST252722 (lexicon)
OST234876 (lexicon) OST225262 (lexicon) OST215852 (lexicon) OST207216 (lexicon)
OST193878 (lexicon) OST189098 (lexicon) OST184737 (lexicon) OST159736 (lexicon)
OST152383 (lexicon) OST151145 (lexicon) OST114585 (lexicon) OST111835 (lexicon)
OST111573 (lexicon) OST108676 (lexicon) OST103487 (lexicon) OST87504 (lexicon)
OST57215 (lexicon) OST39864 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI3145
Vector Insertion
Chr 5: 108510155 - 108510238
Public Clones CF0144 (sanger) XG512 (baygenomics) RRK366 (baygenomics) XD143 (baygenomics)
D043D07 (ggtc) P062F09 (ggtc) D028G06 (ggtc) P124C09 (ggtc) W245E05 (ggtc)
P100D04 (ggtc) P142F03 (ggtc) M005F05 (ggtc) D031G04 (ggtc) D047F07 (ggtc)
P095D07 (ggtc) P114A12 (ggtc) P106G02 (ggtc) M015E02 (ggtc) P123D01 (ggtc)
P089A06 (ggtc) M003F04 (ggtc) D047G09 (ggtc) D014F12 (ggtc) P093B08 (ggtc)
D016G04 (ggtc) P142G03 (ggtc) M016A06 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI15236
Vector Insertion
Chr 5: 108510238 - 108516017
Public Clones (sanger) P123D01 (ggtc) E078F03 (ggtc) D028G06 (ggtc) P142G03 (ggtc)
P095D07 (ggtc) E043A07 (ggtc) D016G04 (ggtc) P124C09 (ggtc) E078F04 (ggtc)
D031G04 (ggtc) P106G02 (ggtc) E070H06 (ggtc) P093B08 (ggtc) D047G09 (ggtc)
P100D04 (ggtc) P142F03 (ggtc) H007C01 (ggtc) D043D07 (ggtc) PST9085-NL (escells)
PST23914-NR (escells) PST17675-NL (escells) PST20600-NR (escells) PST4564-NR (escells)
PST22526-NL (escells) PST18203-NR (escells) PST9498-NR (escells) PST22537-NR (escells)
PST16428-NL (escells) PST18932-NR (escells) PST5679-NR (escells) PST22265-NL (escells)
PST17689-NL (escells) PST5617-NL (escells) PST22513-NR (escells) PST11024-NL (escells)
PST25467-NR (escells) PST18307-NR (escells) IST14228A9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI18189
Vector Insertion
Chr 5: 108516017 - 108516114
Public Clones not available
Private Clones OST428079 (lexicon) OST427328 (lexicon) OST392145 (lexicon) OST382312 (lexicon)
OST352270 (lexicon) OST314209 (lexicon) OST267066 (lexicon) OST267051 (lexicon)
OST262133 (lexicon) OST198881 (lexicon) OST197203 (lexicon) OST194478 (lexicon)
OST171210 (lexicon) OST167577 (lexicon) OST154519 (lexicon) OST34413 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI13073
Vector Insertion
Chr 5: 108516114 - 108516314
Public Clones D014F12 (ggtc) CMHD-GT_45A4-3 (cmhd) CMHD-GT_403G2-3 (cmhd) CMHD-GT_343A8-3 (cmhd)
PST19625-NL (escells)
Private Clones OST406800 (lexicon) OST314208 (lexicon) OST298655 (lexicon) OST273686 (lexicon)
OST262051 (lexicon) OST238561 (lexicon) OST237795 (lexicon) OST234889 (lexicon)
OST233703 (lexicon) OST209004 (lexicon) OST205509 (lexicon) OST162857 (lexicon)
OST162761 (lexicon) OST115088 (lexicon) OST103573 (lexicon) OST97442 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI4412
Vector Insertion
Chr 5: 108516416 - 108516959
Public Clones AD0746 (sanger) XE829 (baygenomics) XE827 (baygenomics) XE830 (baygenomics)
XE828 (baygenomics) W245E04 (ggtc) W245E02 (ggtc) W240B01 (ggtc)
W246D03 (ggtc) W245D04 (ggtc) PST20157-NL (escells)
Private Clones OST55165 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI935
Vector Insertion
Chr 5: 108517109 - 108521079
Public Clones (sanger) BC0040 (sanger) W251A03 (ggtc) CMHD-GT_506B1-3 (cmhd)
Private Clones OST471039 (lexicon) OST420021 (lexicon) OST277344 (lexicon) OST277294 (lexicon)
OST237950 (lexicon) OST222045 (lexicon) OST87765 (lexicon) OST71092 (lexicon)
OST44733 (lexicon) OST42270 (lexicon) OST38240 (lexicon)
Severity of mutation (?) Insertion after 22% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI9971
Vector Insertion
Chr 5: 108521176 - 108522356
Public Clones XE120 (baygenomics) XC821 (baygenomics)
Private Clones OST345948 (lexicon) OST47686 (lexicon)
Severity of mutation (?) Insertion after 29% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI10087
Vector Insertion
Chr 5: 108522426 - 108523143
Public Clones XC784 (baygenomics) XC776 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 33% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI4843
Vector Insertion
Chr 5: 108523268 - 108528137
Public Clones AJ0352 (sanger) (ggtc)
Private Clones OST470571 (lexicon) OST464447 (lexicon) OST402933 (lexicon) OST349518 (lexicon)
OST344766 (lexicon) OST341562 (lexicon) OST340592 (lexicon) OST67380 (lexicon)
OST65192 (lexicon) OST59720 (lexicon) OST58904 (lexicon) OST54125 (lexicon)
OST51333 (lexicon) OST47737 (lexicon) OST46424 (lexicon) OST43527 (lexicon)
OST36791 (lexicon)
Severity of mutation (?) Insertion after 42% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI8991
Vector Insertion
Chr 5: 108528206 - 108529831
Public Clones XF052 (baygenomics)
Private Clones OST237200 (lexicon) OST182864 (lexicon) OST66487 (lexicon)
Severity of mutation (?) Insertion after 46% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI31274
Vector Insertion
Chr 5: 108535606 - 108536644
Public Clones IST12313D1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 76% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000112623

































 - UNI796 - - UNI4551 - - UNI15818 -  - UNI10939 - - UNI11062 - - UNI14993 -  - UNI3145 - - UNI10939

 - - UNI14881 - - UNI17974 -  - UNI3145 - - UNI15236 - - UNI18189 - MVCTICQEEYSEAPNEMVICDKCGQG - UNI






Transcript ENSMUST00000112626


ACCACTTAAGTGACCGAATGAG - UNI796 - - UNI4551 - - UNI10939 - - UNI11062 - - UNI14993 - - UNI15818 - AG




















MR - UNI796 - - UNI4551 - - UNI10939 - - UNI11062 - - UNI14993 - - UNI15818 - RDSTGAGNSLVHKRSPLRRNQK








Transcript ENSMUST00000081567


GCACCACTTAAGTGACCGAATGAG - UNI796 - - UNI4551 - - UNI10939 - - UNI11062 - - UNI14993 - - UNI15818 - 









































MR - UNI796 - - UNI4551 - - UNI10939 - - UNI11062 - - UNI14993 - - UNI15818 - RDSTGAGNSLVHKRSPLRRNQK








Transcript ENSMUST00000112628


GCACCACTTAAGTGACCGAATGAG - UNI796 - - UNI4551 - - UNI10939 - - UNI11062 - - UNI14993 - - UNI15818 - 









































SGWHHLSDRMR - UNI796 - - UNI4551 - - UNI10939 - - UNI11062 - - UNI14993 - - UNI15818 - RDSTGAGNSLVHK










For any suggestions or comments, please send an email to