Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000029454 (Mapkapk5)
Chromosomal location
Chr 5: 121975057 - 121995901 (-)
MAP kinase-activated protein kinase 5 Gene [Source:MGI (curated);Acc:Mapkapk5-005]
Human Ortholog
ENSG00000089022 (MAPKAPK5)
Omim not available
UniTrap UNI24993
Vector Insertion
Chr 5: 121990585 - 121995173
Public Clones 3SE289F01 (ggtc) (ggtc) IST14747D7 (tigm) IST14651B1 (tigm)
Private Clones OST198642 (lexicon) OST60884 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI21103
Vector Insertion
Chr 5: 121989257 - 121990510
Public Clones 5SE288D01 (ggtc) D062H06 (ggtc) 3SE288D01 (ggtc) CMHD-GT_269D8-3 (cmhd)
IST13695G5 (tigm)
Private Clones OST341228 (lexicon) OST313562 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI18475
Vector Insertion
Chr 5: 121988500 - 121989180
Public Clones (ggtc)
Private Clones OST422758 (lexicon) OST310631 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI21062
Vector Insertion
Chr 5: 121987230 - 121987661
Public Clones not available
Private Clones OST342812 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI38700
Vector Insertion
Chr 5: 121985862 - 121987230
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 28% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI27437
Vector Insertion
Chr 5: 121984440 - 121985862
Public Clones IST12866H1 (tigm)
Private Clones OST59526 (lexicon) OST43431 (lexicon) OST37888 (lexicon)
Severity of mutation (?) Insertion after 34% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI4313
Vector Insertion
Chr 5: 121977231 - 121978878
Public Clones AG0121 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 68% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI22078
Vector Insertion
Chr 5: 121975249 - 121975671
Public Clones not available
Private Clones OST309348 (lexicon)
Severity of mutation (?) Insertion after 94% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000031410




























Transcript ENSMUST00000111787


























Transcript ENSMUST00000111786







GGACAGCGACATGGAGAAAGCCATCAAG - UNI18475 - - UNI21062 - - UNI21103 - - UNI24993 - - UNI27437 - GACGCC











MSEDSDMEKAIK - UNI18475 - - UNI21062 - - UNI21103 - - UNI24993 - - UNI27437 - DAPVKLCDFGFAKVDQGDLMTP




Transcript ENSMUST00000111783





















Transcript ENSMUST00000111782










MSEDSDMEKAIK - UNI18475 - - UNI21062 - - UNI21103 - - UNI24993 - - UNI27437 - DAPVKLCDFGFAKVDQGDLMTP




Transcript ENSMUST00000111781


















For any suggestions or comments, please send an email to