Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000030849 (Fgfr2)
Chromosomal location
Chr 7: 137305967 - 137410322 (-)
fibroblast growth factor receptor 2 Gene [Source:MGI (curated);Acc:Fgfr2-004]
NP_963895.2 NP_034337.2 
Human Ortholog
ENSG00000066468 (FGFR2)
UniTrap UNI26775
Vector Insertion
Chr 7: 137405581 - 137409307
Public Clones E044C04 (ggtc) IST14234C1 (tigm)
Private Clones OST98324 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI11803
Vector Insertion
Chr 7: 137405262 - 137405372
Public Clones G020D11 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI29571
Vector Insertion
Chr 7: 137385891 - 137405372
Public Clones E325E08 (ggtc) IST12715E8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 8% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI11400
Vector Insertion
Chr 7: 137384792 - 137385891
Public Clones G002B04 (ggtc) G019D03 (ggtc)
Private Clones OST203829 (lexicon) OST57491 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI12177
Vector Insertion
Chr 7: 137372307 - 137384713
Public Clones G002F05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 8% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI14996
Vector Insertion
Chr 7: 137344496 - 137362636
Public Clones PST14849-NL (escells) IST14886D12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 6% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI30700
Vector Insertion
Chr 7: 137328742 - 137339889
Public Clones IST11428A9HMF1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 46% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000117872



















































Transcript ENSMUST00000120187








































Transcript ENSMUST00000122054












































Transcript ENSMUST00000033138































































Transcript ENSMUST00000106209



























































Transcript ENSMUST00000068807


























































Transcript ENSMUST00000106208
























































Transcript ENSMUST00000121064

AACCAGAAG - UNI11400 - - UNI11803 - - UNI12177 - - UNI14996 - - UNI29571 - AACGGTCACCACACCGGCCCATCCT

























Transcript ENSMUST00000117754

AACCAGAAG - UNI11400 - - UNI11803 - - UNI12177 - - UNI14996 - - UNI29571 - AACGGTCACCACACCGGCCCATCCT

























Transcript ENSMUST00000120715






























Transcript ENSMUST00000119260



































Transcript ENSMUST00000117089



































Transcript ENSMUST00000117691



































Transcript ENSMUST00000120141































Transcript ENSMUST00000117357






























Transcript ENSMUST00000117858




































Transcript ENSMUST00000122448































Transcript ENSMUST00000118296
































Transcript ENSMUST00000121080































Transcript ENSMUST00000117073
































For any suggestions or comments, please send an email to