Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000032913 (Lrig2)
Chromosomal location
Chr 3: 104257907 - 104315779 (-)
leucine-rich repeats and immunoglobulin-like domains 2 Gene [Source:MGI Symbol;Acc:MGI:2443718]
Human Ortholog
ENSG00000198799 (LRIG2)
Omim not available
UniTrap UNI10326
Vector Insertion
Chr 3: 104301478 - 104315378
Public Clones LST050 (baygenomics) G065H12 (ggtc) IST14803H5 (tigm) IST12242D2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 11% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI10597
Vector Insertion
Chr 3: 104298629 - 104301411
Public Clones P069G02 (ggtc) P070C06 (ggtc) IST12292C11 (tigm) IST10890B8 (tigm)
Private Clones OST434050 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI25908
Vector Insertion
Chr 3: 104295756 - 104297980
Public Clones not available
Private Clones OST152426 (lexicon) OST127332 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI19837
Vector Insertion
Chr 3: 104295478 - 104295611
Public Clones not available
Private Clones OST379246 (lexicon) OST354801 (lexicon) OST211210 (lexicon) OST188054 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI24419
Vector Insertion
Chr 3: 104294597 - 104294790
Public Clones not available
Private Clones OST221673 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI8933
Vector Insertion
Chr 3: 104283774 - 104284031
Public Clones RST656 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 11% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI34489
Vector Insertion
Chr 3: 104257906 - 104265612
Public Clones IST13899A9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 91% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000106793




T - UNI8933 - - UNI10326 - - UNI10597 - - UNI19837 - - UNI24419 - - UNI25908 - TGTTCTGAACACAAGCAGTTT

































































Transcript ENSMUST00000046316




















































































For any suggestions or comments, please send an email to