Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000036617 (Etl4)
Chromosomal location
Chr 2: 19831407 - 20732340 (+)
enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]
Mm.397986 Mm.237935 
Human Ortholog
ENSG00000120549 (KIAA1217)
Omim not available
UniTrap UNI31095
Vector Insertion
Chr 2: 19831907 - 20038599
Public Clones IST12990B10 (tigm) IST13802A10 (tigm) IST12243D1 (tigm) IST14149E3 (tigm)
IST14566H2 (tigm) IST14159A12 (tigm) IST15083G7 (tigm) IST11565B3 (tigm)
IST10699A11 (tigm) IST12592E7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI33924
Vector Insertion
Chr 2: 20038681 - 20211539
Public Clones IST14331G5 (tigm) IST12358B9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI34866
Vector Insertion
Chr 2: 20211669 - 20261548
Public Clones IST13324G1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI31842
Vector Insertion
Chr 2: 20261737 - 20431673
Public Clones (sanger) IST11656A1 (tigm) IST11759H12 (tigm) IST14803H11 (tigm) IST10785B1 (tigm)
IST11534F11 (tigm) IST10427D3 (tigm) IST11107G9 (tigm) IST10843H5 (tigm)
IST10292G4 (tigm) IST13103D12 (tigm) IST11009C12 (tigm) IST11040B8 (tigm)
IST13986E2 (tigm) IST14410F9 (tigm) IST10324H7 (tigm) IST11418E11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI32282
Vector Insertion
Chr 2: 20431887 - 20441454
Public Clones (sanger) IST13290H1 (tigm) IST14857H4 (tigm) IST10233A5 (tigm) IST12544G6 (tigm)
IST10239F2 (tigm) IST12987D8 (tigm) IST11973C8 (tigm) IST10023B1 (tigm)
IST11830C9 (tigm) IST13063F8 (tigm) IST11791C1 (tigm) IST10041D3 (tigm)
IST11128H6 (tigm) IST12092E4 (tigm) IST12102F3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI5668
Vector Insertion
Chr 2: 20441139 - 20441555
Public Clones CSI632 (baygenomics) YHB036 (baygenomics) XD075 (baygenomics) W007E11 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI29474
Vector Insertion
Chr 2: 20441555 - 20451585
Public Clones (sanger) P146D02 (ggtc) IST10930H8 (tigm) IST12549C6 (tigm) IST11265A6 (tigm)
IST10386E6 (tigm) IST10607H12 (tigm) IST10515C7 (tigm) IST10037G5 (tigm)
IST14662G1 (tigm) IST13079C11 (tigm) IST12964B1 (tigm) IST12721H12 (tigm)
IST11070H7 (tigm) IST12351D6 (tigm) IST12783C10 (tigm) IST12110F1 (tigm)
IST12542D4 (tigm) IST14334G4 (tigm) IST10290D7 (tigm) IST10491H1 (tigm)
IST10732H10 (tigm) IST12565E10 (tigm) IST11491G12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI30503
Vector Insertion
Chr 2: 20451585 - 20451870
Public Clones Ayu21-T288 (egtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI27183
Vector Insertion
Chr 2: 20451585 - 20451870
Public Clones not available
Private Clones OST67662 (lexicon) OST67660 (lexicon) OST43525 (lexicon) OST37802 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI588
Vector Insertion
Chr 2: 20451870 - 20583524
Public Clones AZ0440 (sanger) DA0059 (sanger) AE0309 (sanger) XB770 (baygenomics)
CSI740 (baygenomics) RRR119 (baygenomics) CSI486 (baygenomics) XK143 (baygenomics)
RRT259 (baygenomics) M125A01 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI16328
Vector Insertion
Chr 2: 20451870 - 20583524
Public Clones (sanger) D109F07 (ggtc) 3SE286B09 (ggtc) M125A01 (ggtc) E106B04 (ggtc)
E057B09 (ggtc) M122F10 (ggtc) D145E11 (ggtc) 5SE306B05 (ggtc) E125E09 (ggtc)
D077C05 (ggtc) 5SE224H01 (ggtc) E064C08 (ggtc) E041H02 (ggtc) H001A01 (ggtc)
D145E05 (ggtc) 5SE286B09 (ggtc) E109B05 (ggtc) D053B12 (ggtc) 5SE311D09 (ggtc)
E063C01 (ggtc) D155C03 (ggtc) PST18010-NR (escells) IST14924H4 (tigm)
IST11543H10 (tigm) IST11185F8 (tigm) IST12582H10 (tigm) IST12188B4 (tigm)
IST12328A9 (tigm) IST10350F5 (tigm) IST11260B7 (tigm) IST10803F2BBF1 (tigm)
IST10032E1 (tigm) IST14941C8 (tigm) IST12147G9 (tigm) IST11003H8 (tigm)
IST11786G9 (tigm) IST11637E3 (tigm) IST10688G12 (tigm) IST12740A9 (tigm)
IST12758G5 (tigm) IST12870E6 (tigm) IST11526G1 (tigm) IST12897F12 (tigm)
IST11368F8 (tigm) IST12259H3 (tigm) IST10448A3 (tigm) IST11539B2 (tigm)
IST10929A9 (tigm) IST10913D3 (tigm) IST14844F4 (tigm) IST10060D5 (tigm)
IST11786E10 (tigm) IST12910F11 (tigm) IST10074A3 (tigm) IST10302A9HMF1 (tigm)
IST12294F10 (tigm) IST11785F10 (tigm) IST13106A11 (tigm) IST12679C11 (tigm)
IST11170G5 (tigm) IST10708A6 (tigm) IST10079D8 (tigm) IST11074F7 (tigm)
IST10576E12 (tigm) IST10400D7 (tigm) IST10115G10 (tigm) IST12063A5 (tigm)
IST10844F6 (tigm) IST14882C5 (tigm) IST12861H8 (tigm) IST11311G8 (tigm)
IST10468H3 (tigm) IST12294D1 (tigm) IST10827G10 (tigm) IST12327D12 (tigm)
IST12912F12 (tigm) IST11752H2 (tigm) IST12986H7 (tigm) IST10302A9BBF1 (tigm)
IST10298G9 (tigm) IST14709F9 (tigm) IST11709G11 (tigm) IST10961D1 (tigm)
IST12816H8 (tigm) IST14823F6 (tigm) IST10546D5 (tigm)
Private Clones OST463101 (lexicon) OST185775 (lexicon) OST136962 (lexicon) OST119328 (lexicon)
OST40029 (lexicon) OST38263 (lexicon) OST32047 (lexicon) OST30635 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI12768
Vector Insertion
Chr 2: 20583524 - 20583724
Public Clones M013A08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI1514
Vector Insertion
Chr 2: 20583524 - 20583724
Public Clones CC0680 (sanger) AT0343 (sanger) AC0642 (sanger) CSG442 (baygenomics)
TEA028 (baygenomics) TEA044 (baygenomics) W064F06 (ggtc) W064E06 (ggtc)
A055F05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI15271
Vector Insertion
Chr 2: 20583724 - 20631031
Public Clones (sanger) 3SE287B04 (ggtc) D072E12 (ggtc) E102B08 (ggtc) D127B05 (ggtc)
E129F10 (ggtc) E045G08 (ggtc) E120F12 (ggtc) E038D09 (ggtc) PST10209-NR (escells)
PST21883-NR (escells) IST12564B5 (tigm) IST14729A6 (tigm) IST10763F10 (tigm)
IST11565C1 (tigm) IST10517C9 (tigm) IST14828F4 (tigm) IST11170F8 (tigm)
IST10760H9 (tigm) IST12532H2 (tigm) IST10901H3 (tigm) IST13984F10 (tigm)
IST14123C12 (tigm) IST13600H11 (tigm) IST13750C11 (tigm) IST12495C7 (tigm)
IST11743G2 (tigm) IST11122A10 (tigm) IST12279A2 (tigm) IST14026A12 (tigm)
IST13109A9 (tigm) IST10665B10 (tigm) IST11389A2 (tigm) IST14944E5 (tigm)
IST12633F8 (tigm) IST10171B3 (tigm) IST12495D7 (tigm) IST10692A11 (tigm)
IST12002H4 (tigm) IST10910B11 (tigm) IST13630D1 (tigm) IST10100F11 (tigm)
IST14371H3 (tigm) IST12719B2 (tigm) IST14466E11 (tigm) IST14769H2 (tigm)
IST15053G3 (tigm) IST11917A4 (tigm) IST10528G4 (tigm) IST10854H12 (tigm)
IST12875C12 (tigm) IST13590G2 (tigm) IST13785E8 (tigm) IST11402B5 (tigm)
IST11817G9 (tigm) IST14965C3 (tigm) IST14799H3 (tigm) IST11310A8 (tigm)
IST14302D1 (tigm) IST12311E2 (tigm) IST10517C9BBF1 (tigm) IST10056A5 (tigm)
IST13140F4 (tigm) IST13776C9 (tigm) IST11141G8 (tigm) IST13023E11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI2242
Vector Insertion
Chr 2: 20631031 - 20631231
Public Clones AL0474 (sanger)
Private Clones OST208634 (lexicon) OST159595 (lexicon) OST124377 (lexicon) OST65012 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI30032
Vector Insertion
Chr 2: 20631231 - 20634981
Public Clones D147B08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI37534
Vector Insertion
Chr 2: 20634981 - 20635076
Public Clones Ayu21-T493 (egtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI30556
Vector Insertion
Chr 2: 20635076 - 20644251
Public Clones IST12163A5HMR1 (tigm) IST12724C4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI4124
Vector Insertion
Chr 2: 20635076 - 20644251
Public Clones AN0314 (sanger) YHD460 (baygenomics) M118B05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI29852
Vector Insertion
Chr 2: 20644351 - 20658940
Public Clones (sanger) E045F03 (ggtc) E018G10 (ggtc) D141G11 (ggtc) IST10890F6 (tigm)
IST10890E6 (tigm) IST14912D10 (tigm) IST13683H1 (tigm) IST12032E9 (tigm)
IST10394E1 (tigm) IST11007A3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI29789
Vector Insertion
Chr 2: 20659183 - 20665085
Public Clones (sanger) E068C09 (ggtc) E059F07 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI21116
Vector Insertion
Chr 2: 20665085 - 20665919
Public Clones not available
Private Clones OST340718 (lexicon) OST207168 (lexicon) OST114931 (lexicon) OST95191 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI27753
Vector Insertion
Chr 2: 20681841 - 20681892
Public Clones not available
Private Clones OST50440 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI5224
Vector Insertion
Chr 2: 20681892 - 20688198
Public Clones YTC066 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI8240
Vector Insertion
Chr 2: 20688071 - 20688239
Public Clones RRF024 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI10426
Vector Insertion
Chr 2: 20699652 - 20699829
Public Clones D065G04 (ggtc) P022G12 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000114604


































Transcript ENSMUST00000114606

























































DRETS - UNI21116 - - UNI27753 - SEKMVKATANRNQADGAG - UNI5224 - - UNI8240 - - UNI27753 - GTAHVSAGKVLG







Transcript ENSMUST00000114607










































Transcript ENSMUST00000114609










- - UNI1514 - - UNI12768 - - UNI16328 - - UNI27183 - - UNI30503 - ACAAAAAGTCCCAAGCTGTCCCACAGTCCTCAAC






ACCACATGACGAAAGCCGTGAACGGAGACATGAGG - UNI4124 - - UNI21116 - - UNI29789 - - UNI29852 - - UNI30556 - 
































































 - UNI5668 - - UNI32282 -  - UNI5668 - - UNI27183 - - UNI29474 - - UNI30503 -  - UNI588 - - UNI1514 

- - UNI12768 - - UNI16328 - - UNI27183 - - UNI30503 -  - UNI1514 - - UNI2242 - - UNI12768 - - UNI152

71 -  - UNI2242 - - UNI30032 -  - UNI4124 - - UNI21116 - - UNI29789 - - UNI29852 - - UNI30556 - MQRE


















Transcript ENSMUST00000114608






































































DRETS - UNI21116 - - UNI27753 - SEKMVKATANRNQADGAG - UNI5224 - - UNI8240 - - UNI27753 - GTAHVSAGKVLG














Transcript ENSMUST00000114610











TCATGGGCCACCAGGAGAGGCTGAGGGACCAG - UNI588 - - UNI1514 - - UNI12768 - - UNI16328 - - UNI27183 - - UNI





















 - UNI31095 -  - UNI33924 -  - UNI5668 - - UNI27183 - - UNI29474 - - UNI30503 - - UNI31842 - - UNI32








Transcript ENSMUST00000066509


































































































Transcript ENSMUST00000114614










- - UNI1514 - - UNI12768 - - UNI16328 - - UNI27183 - - UNI30503 - ACAAAAAGTCCCAAGCTGTCCCACAGTCCTCAAC






ACCACATGACGAAAGCCGTGAACGGAGACATGAGG - UNI4124 - - UNI21116 - - UNI29789 - - UNI29852 - - UNI30556 - 















































 - UNI5668 - - UNI32282 - MEESEGQKCEPNLPPSGDSRQMPQ - UNI5668 - - UNI27183 - - UNI29474 - - UNI30503 


UNI588 - - UNI1514 - - UNI12768 - - UNI16328 - - UNI27183 - - UNI30503 - TKSPKLSHSPQPPNLGDPVEHLSETSG



SHAFNHMTKAVNGDMR - UNI4124 - - UNI21116 - - UNI29789 - - UNI29852 - - UNI30556 - MQREIVYARGDGLVAPRPG












Transcript ENSMUST00000045555










- - UNI1514 - - UNI12768 - - UNI16328 - - UNI27183 - - UNI30503 - ACAAAAAGTCCCAAGCTGTCCCACAGTCCTCAAC






ACCACATGACGAAAGCCGTGAACGGAGACATGAGG - UNI4124 - - UNI21116 - - UNI29789 - - UNI29852 - - UNI30556 - 















































 - UNI5668 - - UNI32282 - MEESEGQKCEPNLPPSGDSRQMPQ - UNI5668 - - UNI27183 - - UNI29474 - - UNI30503 


UNI588 - - UNI1514 - - UNI12768 - - UNI16328 - - UNI27183 - - UNI30503 - TKSPKLSHSPQPPNLGDPVEHLSETSG



SHAFNHMTKAVNGDMR - UNI4124 - - UNI21116 - - UNI29789 - - UNI29852 - - UNI30556 - MQREIVYARGDGLVAPRPG












Transcript ENSMUST00000114619










- - UNI1514 - - UNI12768 - - UNI16328 - - UNI27183 - - UNI30503 - ACAAAAAGTCCCAAGCTGTCCCACAGTCCTCAAC






ACCACATGACGAAAGCCGTGAACGGAGACATGAGG - UNI4124 - - UNI21116 - - UNI29789 - - UNI29852 - - UNI30556 - 
















































 - UNI5668 - - UNI32282 - MEESEGQKCEPNLPPSGDSRQMPQ - UNI5668 - - UNI27183 - - UNI29474 - - UNI30503 


UNI588 - - UNI1514 - - UNI12768 - - UNI16328 - - UNI27183 - - UNI30503 - TKSPKLSHSPQPPNLGDPVEHLSETSG



SHAFNHMTKAVNGDMR - UNI4124 - - UNI21116 - - UNI29789 - - UNI29852 - - UNI30556 - MQREIVYARGDGLVAPRPG












Transcript ENSMUST00000114620










- - UNI1514 - - UNI12768 - - UNI16328 - - UNI27183 - - UNI30503 - ACAAAAAGTCCCAAGCTGTCCCACAGTCCTCAAC






ACCACATGACGAAAGCCGTGAACGGAGACATGAGG - UNI4124 - - UNI21116 - - UNI29789 - - UNI29852 - - UNI30556 - 

































































 - UNI5668 - - UNI32282 - MEESEGQKCEPNLPPSGDSRQMPQ - UNI5668 - - UNI27183 - - UNI29474 - - UNI30503 


UNI588 - - UNI1514 - - UNI12768 - - UNI16328 - - UNI27183 - - UNI30503 - TKSPKLSHSPQPPNLGDPVEHLSETSG



SHAFNHMTKAVNGDMR - UNI4124 - - UNI21116 - - UNI29789 - - UNI29852 - - UNI30556 - MQREIVYARGDGLVAPRPG


















Transcript ENSMUST00000114624


GGCGGCTCACAAAG - UNI5668 - - UNI27183 - - UNI29474 - - UNI30503 - - UNI31842 - - UNI32282 - AACAAGGG










GCCGTGAACGGAGACATGAGG - UNI4124 - - UNI21116 - - UNI29789 - - UNI29852 - - UNI30556 - ATGCAGAGAGAAAT








































27183 - - UNI30503 - TKSPKLS - UNI1514 - - UNI2242 - - UNI12768 - - UNI15271 -  - UNI2242 - - UNI300

32 -  - UNI4124 - - UNI21116 - - UNI29789 - - UNI29852 - - UNI30556 -  - UNI21116 - - UNI27753 -  - 

UNI5224 - - UNI8240 - - UNI27753 -  - UNI8240 - - UNI10426 -  - UNI10426 -     
Transcript ENSMUST00000114627



GCTCAGAGGAAGGCAGCGGCGGCTCACAAAG - UNI5668 - - UNI27183 - - UNI29474 - - UNI30503 - - UNI31842 - - UN




88 - - UNI1514 - - UNI12768 - - UNI16328 - - UNI27183 - - UNI30503 - ACAAAAAGTCCCAAGCTGTCCCACAGTCCTC








































































 - - UNI27183 - - UNI29474 - - UNI30503 - - UNI31842 - - UNI32282 - EQGRSNLHVTSQEDAACRRPRERLSNGNARAQ
























For any suggestions or comments, please send an email to