Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000040111 (Gramd1b)
Chromosomal location
Chr 9: 40100818 - 40338968 (-)
GRAM domain containing 1B Gene [Source:MGI (curated);Acc:Gramd1b-002]
Human Ortholog
ENSG00000023171 (GRAMD1B)
Omim not available
UniTrap UNI30778
Vector Insertion
Chr 9: 40262878 - 40338969
Public Clones IST11648H8 (tigm) IST13960E8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI32263
Vector Insertion
Chr 9: 40220881 - 40263350
Public Clones (sanger) IST14661C1 (tigm) IST14601B1 (tigm) IST11658D4 (tigm) IST14891F6 (tigm)
IST14014A2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI29712
Vector Insertion
Chr 9: 40199264 - 40220960
Public Clones (sanger) E100B06 (ggtc) D078C11 (ggtc) D156C11 (ggtc) IST13355C5 (tigm)
IST14247C5 (tigm) IST13811A9 (tigm) IST14112F5 (tigm) IST12522G5 (tigm)
IST10441C4 (tigm) IST14771B6 (tigm) IST10916E2 (tigm) IST12342D8 (tigm)
IST13097F2 (tigm) IST12592H3 (tigm) IST10916F2 (tigm) IST10571D10 (tigm)
IST14987B3 (tigm) IST12156E2 (tigm) IST13098D2 (tigm) IST10662A2 (tigm)
IST14921E3 (tigm) IST10818C12 (tigm) IST10589C1 (tigm) IST13811E9 (tigm)
IST11719E7 (tigm) IST14374C9 (tigm) IST12090E1 (tigm) IST10571C6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI32724
Vector Insertion
Chr 9: 40153492 - 40199738
Public Clones (ggtc) 5SE287H01 (ggtc) 3SE287H01 (ggtc) IST14604A3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI32499
Vector Insertion
Chr 9: 40141029 - 40153876
Public Clones (sanger) IST11549D11 (tigm) IST12241G3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI19432
Vector Insertion
Chr 9: 40141020 - 40141241
Public Clones not available
Private Clones OST391269 (lexicon) OST290054 (lexicon) OST288747 (lexicon) OST282834 (lexicon)
OST251136 (lexicon) OST216003 (lexicon) OST170673 (lexicon) OST143683 (lexicon)
OST130145 (lexicon) OST108668 (lexicon) OST80629 (lexicon) OST66620 (lexicon)
OST53449 (lexicon) OST42697 (lexicon) OST42696 (lexicon) OST39183 (lexicon)
OST33639 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI13140
Vector Insertion
Chr 9: 40135024 - 40141029
Public Clones CMHD-GT_324H3-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 5% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI23968
Vector Insertion
Chr 9: 40135024 - 40141029
Public Clones IST11621A12 (tigm)
Private Clones OST239093 (lexicon) OST232742 (lexicon) OST230085 (lexicon) OST131714 (lexicon)
OST108807 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI35871
Vector Insertion
Chr 9: 40125093 - 40135024
Public Clones IST15105F6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 6% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI23363
Vector Insertion
Chr 9: 40124554 - 40125093
Public Clones not available
Private Clones OST262172 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000118159






























40 - - UNI19432 - - UNI23968 - - UNI32499 - - UNI35871 - KSQSWYN - UNI35871 - VLSPTYKQRNEDFRKLFKQLPD







Transcript ENSMUST00000121357






ACAGTCTGGTCGGAGCGGTGGTAAAAATTCCAAG - UNI13140 - - UNI19432 - - UNI23968 - - UNI32499 - - UNI35871 - 





































































SCSSQSGRSGGKNSK - UNI13140 - - UNI19432 - - UNI23968 - - UNI32499 - - UNI35871 - KSQSWYN - UNI35871 








Transcript ENSMUST00000045682

































SSDKSPSTPEQGVQRSCSSQSGRSGGKNSK - UNI13140 - - UNI19432 - - UNI23968 - - UNI32499 - - UNI35871 - KSQS








Transcript ENSMUST00000119373










































SSQSGRSGGKNSKVSR - UNI13140 - - UNI19432 - - UNI23968 - - UNI35871 - KSQSWYN - UNI35871 - VLSPTYKQRN








For any suggestions or comments, please send an email to