Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000040848 (Sft2d2)
Chromosomal location
Chr 1: 167104628 - 167124480 (-)
Description
SFT2 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1917362]
Human Ortholog
not available
Omim not available
UniTrap UNI38598
Vector Insertion
Chr 1: 167118378 - 167124452
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 12% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000111457
Sequence
GAGTGGTAGGCGGAGCGAACGCCAAAGGCGGCGGTCGGGACCCTGACATGGACAAGCTGAAGAAAGTTCTGAGCGGCCAGGACACCGAGGACCGCAGCGG

TCTGTCCGAG - UNI38598 - GTTGTGGAGGCGTCGTCGCTGAGCTGGGGCACCAGAATAAAAGGCTTCATCGCATGCTTTGCTCTGGGAATCCTGT

GCTCAGTGCTG - UNI38598 - GGGACTCTTCTGCTGTGGGTGCCCAGGAAGGGACTCGGCCTCTTTGCAGTGTTTTACACCCTGGGTAACATCATG

TCAATTGGGAG TACCGTCTTCCTCATGGGGCCGCTGAAGCAGCTGAAGCGCATGTTTGAGCCTACGCGTCTCATCGCCACAATTCTGGTGCTG CTGTG

TTTTGCACTTACCCTGTGTTCTGCCTTTTTG TGGAATAAGGGACTTGCACTCATCTTCTGTATTTTGCAGTCTTTGGCCTTGACGTG GTATAGCCTTT

CCTATATACCGTATGCAAG GGATGCCGTGAAGAAGTGCTTTGCT GTGTGGCTTGCAATTTGGACATTTTTGAGGGTTGCCTGTGGGAATAGTCATGAG

TCCTAGACCCTAATGTCTGTAACACAATCCGAGGCTCTGTGGCTTGTGTAGACAACTCTTCTTGTGACCATTAACCTCTGGGAGGTATTCCACTGACTTC

TCACAGAGCAGCTTTGTCTGGTAGCAGCAGATCAGCCTCAGGAGCAACTGATTCCCAGGTGGCAGCAGGAAGGTCTAGCAGGGCTTCTAGCGGAGCAGCA

GGAAGTACAGAATTTTGAAGATTTGCCCCTCACCAGGAAAACCATTGCCACAGTCCCTGCACAGCGTCTTCCCTGCTGTTTGAGAACAAGTGATTCTGCC

CAGACCCTGGAGAGCCTGCCCGGGATACATTGTTCCTTTCCCTGCATGGCACCGTCTTGCTATTCTGAACTCAGCTGGCTATGAAATACACTTTTAGTGT

TCAATGTG
Translation
MDKLKKVLSGQDTEDRSGLSE - UNI38598 - VVEASSLSWGTRIKGFIACFALGILCSVL - UNI38598 - GTLLLWVPRKGLGLFAVFYTLG

NIMSIGS STVFLMGPLKQLKRMFEPTRLIATILVL LCFALTLCSAFL WNKGLALIFCILQSLALTW WYSLSYIPYAR RDAVKKCFA VWLAIWTF

LRVACGNSHES
Transcript ENSMUST00000043338
Sequence
GGCGGTCGGGACCCTGACATGGACAAGCTGAAGAAAGTTCTGAGCGGCCAGGACACCGAGGACCGCAGCGGTCTGTCCGAG - UNI38598 - GTTGT

GGAGGCGTCGTCGCTGAGCTGGGGCACCAGAATAAAAGGCTTCATCGCATGCTTTGCTCTGGGAATCCTGTGCTCAGTGCTG - UNI38598 - GGGA

CTCTTCTGCTGTGGGTGCCCAGGAAGGGACTCGGCCTCTTTGCAGTGTTTTACACCCTGGGTAACATCATGTCAATTGGGAG TACCGTCTTCCTCATGG

GGCCGCTGAAGCAGCTGAAGCGCATGTTTGAGCCTACGCGTCTCATCGCCACAATTCTGGTGCTG CTGTGTTTTGCACTTACCCTGTGTTCTGCCTTTT

TG TGGAATAAGGGACTTGCACTCATCTTCTGTATTTTGCAGTCTTTGGCCTTGACGTG GTATAGCCTTTCCTATATACCGTATGCAAG GGATGCCGT

GAAGAAGTGCTTTGCTGTGTGTCTTGCATAACACACTGCCAGTGTGCAGGGAGCACCGTGGACGGAAGCTGGTGGACAATTCTGTAAATGTCCTCTAAAC

CTCTGTCTCACAGACACGTGCCTTCTGCTTGCAGCGGTGTGTGGCTTGCAATTTGGACATTTTTGAGGGTTGCCTGTGGGAATAGTCATGAGTCCTAGAC

CCTAATGTCTGTAACACAATCCGAGGCTCTGTGGCTTGTGTAGACAACTCTTCTTGTGACCATTAACCTCTGGGAGGTATTCCACTGACTTCTCACAGAG

CAGCTTTGTCTGGTAGCAGCAGATCAGCCTCAGGAGCAACTGATTCCCAGGTGGCAGCAGGAAGGTCTAGCAGGGCTTCTAGCGGAGCAGCAGGAAGTAC

AGAATTTTGAAGATTTGCCCCTCACCAGGAAAACCATTGCCACAGTCCCTGCACAGCGTCTTCCCTGCTGTTTGAGAACAAGTGATTCTGCCCAGACCCT

GGAGAGCCTGCCCGGGATACATTGTTCCTTTCCCTGCATGGCACCGTCTTGCTATTCTGAACTCAGCTGGCTATGAAATACACTTTTAGTGTTCAATGTG

GATTCTTTCTCTTGCCCTTACCTCCTACGTCTTGTTTTGTCTTGTGACACCGGTTAATTGCGAGTGAAGTAGTGACCTAAAAAGCTATTTCCTTTCGGAC

AAGAGCCATTAGAAAGTGAAACATCTTCATGTTCCTTGCTTTGTTTATTTGCCCTCATTATTTATAAATGTTTACTTTCTGTCCTTTGCTGGAGTTGAGA

TAAGGAAAGTACATGGAAGAAAGATCCCTCGTGGGCCAGCAAGAAGGCATGCCTGCCAAGCAACCTAAATGCTCCAGCGTTGACTCTCAGCCTGCACTGG

ACACTAGTAGTCAGCCTGTAGGTGGGCATGCTGCAGCCTAGTGCCTAACCACACACAGCGTTCTTGTGTTGGGGACCTCATCTGGTCCTCATGAGAGCCA

TATGAGTTGTCTCAACTGCAGTCAAGGAACCGGGGCTCAGGTTGGTTTCTGTGTCACAGCTCCAGCTGTGGCTTGGCTCTCAGCCTCTGTTTTGACACTG

AGTCTCCTGGCATGGCTCTCCTCAGAGCGTCTGTCGTCTCTCATAACTGTTCCTTTCATCCTCCTGGCCTGTACCTTTTCTGATTTCAGCATCTATGTCA

ATTGTGCCACCTTCTACCCGCTCCCCCGTTTTGCTTTTTGGCAGCTACGTCTGCATCTGTAGGATGGCCAGCATCCCGTGGTCCCTTTCAGCTGCTCAGT

GCATCCCTTGCATCATTAGTACCCTGTCTTGACAGCTTGAGGTCCTGGCAGTCTATGTTTGCCCTTTGCTCAGGGCCAGCCTTGACCTCTGTTTTTTCAC

CACCAGACCACAGGAGGTGAGAGCACTCATCTCTGCGGTTGTTGCCAGTTGCTGAACTGTGGCTAATGACTGTCTTTTCTTCTGAGATGGAGAACTGTGG

ATAGGCTGATCAGAATTAGGGCAGAAGGGAGCTCAGTCTTTCCAGATTCCAGCCATGCTGTTGAAGGCATCGATGAGGTCTTCAGTCAGGAAGCAAAGTT

ACATGCTACCCTCTGGCTGTGTGAGGCACATTCATGTCCCAGAAGCCTTGGGAATCAGTTCAGGGCTCAGAAGGGCTCAGATGTGAGAACGGCCATTGGG

AAATTTAGGGAAACCCATGGATCCTAGCTGACAGGAGGAGTAGGGTCATTGCTGCAAGCTCCAACCGCCTTGTAGTTATGTACCTAAAAAGCTGACCTCT

CCGTGCCCTTGTCAGGGACTGGGCTTGAGCCCAGGTATCTTTTAAAGATGGTATAGCAAGGATGAAGAGCATAACAGTGTGAACATGGGCTTAGAAAATA

AGCAGATCCAGATGTGGTCCAGTCCCATGCTGGTGATCCAGATGTGGTCCAGTCCCATGCTGGTGATCCAGATGTGGTCCAGTCCCATGCTGGTGGAGGC

CTTGGAAGTTACCTAATGTTTGGTTCCTCAGTTTCACTGTTTCCTAATAGTGGGCTGACAAGTCCTGCTGGCTCACTGGAGGATGCCGGTGGAAGAGAAT

GCATCAAGGGCTTGGGGCGCATGTGGCACAGCAAGTTGGGTCTCCATGAACTAACTGATGAGTGCTAAAGGTGACAGGATGGGTGCCTGCCTGTCAGTTT

GTCTAGCATATTCTGTGTCCATCACTGTAGACTGTCATGCATTGTCTCACTGAATGGTCACAGTGACTGTCAGGCAACGGATAACTGCCTTCATCATAAA

GTAGTAGTGGTCTCAGAAACTCCCAGGAGCAGGGGCCTCAGTGAGGGTGGTCTAGGTTGAGATCAAGTCTGGATAAAAGGCTTTGGCCTAATTCCTACAG

CCTGTGGCCAGTTTGCTTCAACAGTTTGTGTCTGGACACATTTAAGCAGTTTTTGGATGACTGTCTTCCAGAATCTTCCAGACTCTCAGATTTTTTTTTT

CAGTTGCCTTAACCCTAGGTTGTTTCTGACCCTGCTTTTGCTGGACTATAGAAGGAAGAAAGCCACTTCATATCTGCTAAAGTCTCCTACCAAGCCAGTA

GTATTGATTAAAAGCAACTTAGTGAGTGAGGCTGAAGTGGAGAACTAGCCTCTGACTGTGGCTGTTGGTGTTATCTGTTTCTCCTCCCTACCCTCAATTC

TTCCCCATTCACACCCATGGAGCAGGGCATCCCTGTGTTGCCAACCAATGGGGACTGTTGAGTGATCACTGTAGAGGCAGTGTGGTCCTCAGCCAGGCTG

GTTTCCAGGTGTGGGCCTGATGCTGCCTTCCCTGGGCTGCAGTCTGGAGTGCTTCACTGAGAACACCATTGTGCCTTCTGGACCAGGAGAGTAGCTTCGG

ATCCCCTTGGCTGGTCCAACCTCTACTCCAGGCTGACTGTTGGGATGCTGTGGGGTGGGGGCCTGTCCACTGAATCCTGTCTCTCACTGTCCCTTTTCAC

AGATCAAGCCTAAGGCAGCTTTTGTCTCTCCTGCTCCTCTGTGTGGCTGCTGCTCAGACCCCAGCTCTTAGGCATCTTGTCTTGGGGAAGGGTGAGATGC

ATCCCCAGCTTGGCCTTTTCAGTGCTTGGGTGTCTGTTTCTCTCATGGTGACTTTGTGGATTATGCCTTAATTGCCACCCCCCTTCCACATAGTCACCGT

AGGCTGAGAGAACAAGAAATGAAATCATGAATTGCATTCCATATACGATTACTCTTTAATACTTTGGTTAGAATAAATAATTAGCATCGGGGCAGTATCT

GAAATGGATGTGAAGGGCGGGGCTGGTTTGGCTTTTGTTGTTGGGATCCCCGTGAGTGACAGGTTTTGCCGTGCACGGGATGAGACTTGGTGGAATGAAT

TGGTCAGTCGAGGTGCACCCATGGCTGTGGATTTCCTTTCCTTTGTGCACCCTCTGCCTACTTCCTGACTTTACTCTTCCTCTGGTAACTTCTCAGTAGA

GTCAATTACAACCAAGCCTAAAACTTATTTTTAGTTAATTAAAAATAAAATAAAATCAGTGTTTAAAGCAGTATAAAGATGCCTGCTAGACTTTGTGGCA

GTTTGGTTTTTACTGTTCAAGTATTTTTTTTTTTAATAAGTTTAATAATGTGCTTATAGATAACATCCTTTTAAAAGTGAATGAACCTTAGCTGAAGTTC

ATTGCAAATATACATTTTCCCCTAGAAATCTAAGCTGCTTAGGAAGTTTTATTAAAAGGATTGCTTAGGGGGTGATCTTAAAGTACCTGCCAGTTCACGT

TTTGCTTTGAGATCTTGTGTGTTTTTCGGCTAGCGAAGGGGGAACGCAGTGGAGTTTGTTTAATCCCAGTTTGCTCGGGGTGGAGTGTTCTGCTTTGAGT

ATTTCCAGCCCTGCTGTGACTGTGGGAGACATTTGAAATTAGCTGGTGGCAGAGCCTTCCTTCATATAAGCTGACAATATCAAGTCAGATACATTCTGTC

AGGAGCTGGTAACTGACAAGGTAGACTCGGGATGCACAGAGTGGCTTTCTGCAAACTGGCTGATCTGAAACCAGAGAAAAATAGGCCCAGTATATAGGAA

TTCTGTTGAAGCTGAGAGGTCAGCCCATGGCATCAGAACAAATGATGACACATGCTCTGTACTCAGAACAATGGCACTACATGTCTAGAGTGCCTGCCTA

GCATGGAGCCTGTGGTTCAGTCCCTGGAAATGCATACACTGGGCATGGTGGTGCATGCCAATATCCCAGCACTTGGGAGGTAGAGAGAGGCAGGAGGACC

TAGAGTATATTGGACCCTATCTTTAAAATAATAATAATAATAATCAAAGACCAAGTCTGGTGTTTGGACCCATGCACATGGCTCCATCTGTTAAATGTTC

AAAAAAAATGTTTTTTTTTCTGGCCTTTTCATTGTCTTTGCTTTACCTTGAATAAGGAAGGCAAGGTAAACAAAGCAAGCCTCCCTGGACTCCGTCCTTT

GTAATTCTGACTGTGAAGTTGCCAGTGAGGGTGTGCAGAAGCCACTGATGAAGGCACTGGCTTCCTTGTGTGGGCCCTGGGCACCTGGGCACACTCCCTG

GGAGTAAAACCAAATTCAAATGCCGGTGGTGGATTTGTATGCCTTTAGAACATTGTGCCTGTTCTCATACAGTGAGCTTTCAAAACATTTTGTTTAAAAA

AACAAACAATTTTTATAATTGTGTAGGTATAGTTGATTTTGAATGCTACGGATTGTATAACTGAAATTTTATATACAAAAATATATTCTT
Translation
MDKLKKVLSGQDTEDRSGLSE - UNI38598 - VVEASSLSWGTRIKGFIACFALGILCSVL - UNI38598 - GTLLLWVPRKGLGLFAVFYTLG

NIMSIGS STVFLMGPLKQLKRMFEPTRLIATILVL LCFALTLCSAFL WNKGLALIFCILQSLALTW WYSLSYIPYAR RDAVKKCFAVCLA

For any suggestions or comments, please send an email to unitrap@crg.es