Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000041571 (Sepw1)
Chromosomal location
Chr 7: 16502559 - 16507720 (-)
Description
selenoprotein W, muscle 1 Gene [Source:MGI (curated);Acc:Sepw1-001]
RefSeq_dna
NM_009156 
RefSeq_peptide
NP_033182.1 
MGI
MGI:1100878 
Uniprot/SWISSPROT
P63300 
Human Ortholog
ENSG00000178980 (SEPW1)
Omim not available
UniTrap UNI28391
Vector Insertion
Chr 7: 16505823 - 16507600
Public Clones not available
Private Clones OST32161 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI28121
Vector Insertion
Chr 7: 16505296 - 16505391
Public Clones not available
Private Clones OST39439 (lexicon)
Severity of mutation (?) Insertion after 70% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI17232
Vector Insertion
Chr 7: 16502889 - 16505196
Public Clones not available
Private Clones OST447138 (lexicon) OST281481 (lexicon) OST147807 (lexicon) OST90670 (lexicon)
OST67176 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000044355
Sequence
CGGCTGTGCGCACGGCCCCACGCTCAGAGCTTGAGGTCCTTGTTGCTTGTGGGTCGGGTCCTCGTGTTGTGCGGGGATGCGACGTGCAGCTATGGCGCTC

GCCGTTCGAGTCGTGTATTG - UNI28391 - TGGAGCTTGAGGCTATAAGCCCAAG TACCTCCAGCTCAAGGAGAAGCTAGAACATGAGTTCCCCG

GATGCCTGGACATT TGTGGCGAGGGGACTCCCCAGGTCACCGGGTTCTTTGAAGTGACAGTAGCCGGGAAGTTGGTCCACTCCAAGAAG - UNI2812

1 - AGAGGTGATGGCTATGTGGATACAGAGAGCAAGTTCCGGAAACTGGTGACCGCCATCAAAGCTGCCTTGGCTCAGTGCCAGTGAGCCCTAGAGGCA

GGG - UNI17232 - TCCTGAAAGCTCCTGGCCGGCCTTCCTTGGCAGCCGCTTCATGACAGGAAGGACTGAAATGTCTTAGACCTGTGGTCTTTCCT

CGATGTTCCTGCGGCCACCAAGTCAGGCCAGAGATGGATTCTGGCTGTGGGTGCCTCCCCAGAATCTACCCGTGCACGCAGCCTGCCCTGCCCCCCTGCC

CTCTTCCCCACCTCTCTCTCTGAATTCCCCCATTGTTTCCCACCCACCCTCCTGCTTTGCTTTCCCTTTCCACCTCAAGACTTCAAGAAGACAGGCAGCC

ATGTTTCCAGGTGTTCCCGGTTGAATAAAGTTTGGATGAGGTAACCC
Translation
MALAVRVVYC - UNI28391 - CGA*GYKPK YLQLKEKLEHEFPGCLDI CGEGTPQVTGFFEVTVAGKLVHSKK - UNI28121 - RGDGYVDT

ESKFRKLVTAIKAALAQCQ - UNI17232 - 

For any suggestions or comments, please send an email to unitrap@crg.es