Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000046242 (1600029I14Rik)
Chromosomal location
Chr 9: 99370859 - 99375170 (+)
Description
thioredoxin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1917047]
UniGene
Mm.307159 Mm.426841 
MGI
MGI:1917047 
Uniprot/SPTREMBL
Q9DAT0 
Human Ortholog
not available
Omim not available
UniTrap UNI14000
Vector Insertion
Chr 9: 99371346 - 99374812
Public Clones CMHD-GT_167D8-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 54% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000056103
Sequence
TATCCACCCGCAGGCAGCACAGAGGCATTTAGAGCGGCGCTCAGCACATAGGTCCTAACCTAGCTCGACCAGGATTAGGGTTCTTATCAAGATCAGTCAT

ATTGCTGCACGAGAGGCAAGGTGCTAGAGCTCAGCTGTGACCCAACAACAGTGGGAGTTGTAGTCTCTCTCTGGGCAGAAACGTTGCCAGACTCTGTTTA

ACACCCCTGGGCAGCAGGTGCTGGCACGGCTGATACTCTCCAGTTCTCTACAAAGAGCAAAGCAGTCTGGTAGCTGGTGGTCCTGCTGCCAGAGAGCAAT

GCATTTCTCTTCAAGTGAAACAATTGTTTCTTTTACATTGTACCAACCAGTCTCCGGGCTCAGTACGGCACAGAAATGCCTTTTAATGCTGTGCATGGAA

GCCGGGACAGAGAGGACGCCAACAGAGAGCTGGCGCTGCTCTTCCCCAGTTTCAAGTTCTCAGATAAAGACAAGGAAGCTCCACCGG - UNI14000 -

 GTGCTGAGGCTCAAACTATGGTGGGCCCCGTGGAGGACCCTTGCATGTCTGAGCGTATCTGAGGACTGGAATGCCGTGTTGTCTTCTGCCGGAATCAAA

GTCACAAGGCCACCAGAGGAGCCCTCAGTACACGCCGGTCGGCACAGAAGGCTGCAGAGGTGATTCCAGAGCGCCAATATGTGCTTGGTTTAGCCCTATT

CTGTGGACAACGGAAACAACTGTCCATACGTCTCTGCCTTATTAAACAGTCTGTAGAACACACCCAACTCTAGTCACGGCATTCTGCTGAGGCATGGTGT

AACCTCAGAAGACACTGGGTCTCTTCAACAATAAAGCTTTGATCCTAGTGTGGTACCTT
Translation
MHFSSSETIVSFTLYQPVSGLSTAQKCLLMLCMEAGTERTPTESWRCSSPVSSSQIKTRKLHR - UNI14000 - VLRLKLWWAPWRTLACLSVSEDW

NAVLSSAGIKVTRPPEEPSVHAGRHRRLQR

For any suggestions or comments, please send an email to unitrap@crg.es