Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000053693 (Mast1)
Chromosomal location
Chr 8: 87435752 - 87461258 (-)
microtubule associated serine/threonine kinase 1 Gene [Source:MGI (curated);Acc:Mast1-001]
Q3URY8 Q7TQ97 
Human Ortholog
ENSG00000105613 (MAST1)
Omim not available
UniTrap UNI34379
Vector Insertion
Chr 8: 87445238 - 87447839
Public Clones IST12727C10 (tigm) IST14376E4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 29% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI31361
Vector Insertion
Chr 8: 87442568 - 87444382
Public Clones IST13871A4 (tigm) IST13983A3 (tigm) IST11201A5 (tigm) IST14746D6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 43% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI30918
Vector Insertion
Chr 8: 87440451 - 87441874
Public Clones IST10381D6 (tigm) IST14509D1 (tigm) IST14195H7 (tigm) IST13978F8 (tigm)
IST10598B4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 55% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI31822
Vector Insertion
Chr 8: 87440054 - 87440659
Public Clones IST13596G2 (tigm) IST14013H6 (tigm) IST13642G7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 59% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI31331
Vector Insertion
Chr 8: 87439578 - 87440285
Public Clones (sanger) IST10415E11 (tigm) IST13922E8 (tigm) IST10443E5 (tigm) IST14348E4 (tigm)
IST13172E8 (tigm) IST12487H12 (tigm) IST12507F2 (tigm) IST13351D5 (tigm)
IST10301E10 (tigm) IST11556G11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 64% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI36525
Vector Insertion
Chr 8: 87439353 - 87439702
Public Clones IST13940F7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 67% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI24143
Vector Insertion
Chr 8: 87437407 - 87439353
Public Clones (sanger) IST13032D9 (tigm) IST13750D1 (tigm) IST12741F5 (tigm) IST15098B12 (tigm)
IST10172G5 (tigm) IST10124G9 (tigm) IST14052F12 (tigm) IST14706A10 (tigm)
IST11808E2 (tigm) IST14717D2 (tigm) IST10445H12 (tigm) IST14512F8 (tigm)
IST13390E9 (tigm) IST10703E1 (tigm) IST13349G12 (tigm) IST14512C10 (tigm)
IST10523H10 (tigm) IST14213F1 (tigm) IST13023E1 (tigm)
Private Clones OST232980 (lexicon)
Severity of mutation (?) Insertion after 96% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI35486
Vector Insertion
Chr 8: 87435751 - 87437407
Public Clones IST13881H12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 96% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000074363






































































Transcript ENSMUST00000109741






































































Transcript ENSMUST00000119820




















TAATATCTAGCCTCTTGCAGACCAACCCCCTG - UNI24143 - - UNI30918 - - UNI31331 - - UNI31361 - - UNI31822 - - 









I24143 - - UNI30918 - - UNI31331 - - UNI31361 - - UNI31822 - - UNI35486 - - UNI36525 - PCISRSIAEQAFG


For any suggestions or comments, please send an email to