Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000053877 (Srcap)
Chromosomal location
Chr 7: 134655516 - 134704280 (+)
Snf2-related CREBBP activator protein Gene [Source:MGI Symbol;Acc:MGI:2444036]
Human Ortholog
ENSG00000080603 (SRCAP)
Omim not available
UniTrap UNI30289
Vector Insertion
Chr 7: 134655853 - 134657678
Public Clones D036B11 (ggtc) PST20596-NR (escells) IST14937B10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI14764
Vector Insertion
Chr 7: 134657755 - 134659661
Public Clones (ggtc) D004A04 (ggtc) PST5182-NR (escells) PST23248-NR (escells) PST15527-NL (escells)
PST19980-NR (escells) PST9161-NR (escells) IST13639D8 (tigm)
Private Clones OST279277 (lexicon) OST236131 (lexicon) OST225241 (lexicon) OST216251 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI7412
Vector Insertion
Chr 7: 134659455 - 134659716
Public Clones RRS665 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI14763
Vector Insertion
Chr 7: 134659716 - 134663094
Public Clones (sanger) D004B03 (ggtc) PST15527-NR (escells) IST11636C12 (tigm) IST14229G10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI22478
Vector Insertion
Chr 7: 134663094 - 134663347
Public Clones not available
Private Clones OST295902 (lexicon) OST250695 (lexicon) OST213684 (lexicon) OST45297 (lexicon)
OST44098 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI12352
Vector Insertion
Chr 7: 134663170 - 134663347
Public Clones A024F03 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI804
Vector Insertion
Chr 7: 134678494 - 134681514
Public Clones CH0238 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 30% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI5167
Vector Insertion
Chr 7: 134686222 - 134692653
Public Clones YTC083 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 56% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI1412
Vector Insertion
Chr 7: 134696809 - 134700921
Public Clones CH0649 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 68% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI4422
Vector Insertion
Chr 7: 134701822 - 134701962
Public Clones AD0254 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 75% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000066582







CCTACAGACACAG - UNI7412 - - UNI14763 - - UNI22478 - ATGGTGTCGGACGGCATGACAG - UNI12352 - - UNI22478 -




























 - UNI30289 -  - UNI7412 - - UNI14764 - MQSSPSTAHPQLPILQTQ - UNI7412 - - UNI14763 - - UNI22478 - MVS










Transcript ENSMUST00000098025







Transcript ENSMUST00000084563



































































































 - UNI30289 -  - UNI7412 - - UNI14764 -  - UNI7412 - - UNI14763 - - UNI22478 - MVSDGMTGSNPVSPASSSSPD

































For any suggestions or comments, please send an email to