Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/gene.php on line 256
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000074243 (AC164532.4-202)
Chromosomal location
Chr 7: 28549288 - 28734835 (-)
Description
not available
Human Ortholog
not available
Omim not available
UniTrap UNI31160
Vector Insertion
Chr 7: 28549287 - 28734836
Public Clones (sanger) IST14374D5 (tigm) IST13270C5 (tigm) IST10806B2 (tigm) IST10600F7 (tigm)
IST13401A11 (tigm) IST15061D4 (tigm) IST12369B4 (tigm) IST10875G9 (tigm)
IST13271C4 (tigm) IST14313A9 (tigm) IST13943B8 (tigm) IST15093G7 (tigm)
IST15061F6 (tigm) IST10022B9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000098638
Sequence
AGGCAGAGGCAGGCAGATTTTAGCGGCTCTGCCTGGAACCTAAATCGAAAAACATGAGTTGCGTGCCATGGAAAGGAGACAAGGCCAAAGCTGAATCCTC

GGACCTTCCCCAAGCAGCACCCCCACAAATCTACCATGAGAAGCAGCGCAGGGAGCTCTGTGCTCTTCATGCTCTCAACAACGTCTTCCAGGACAGCAAC

GCCTTCACGCGGGAAACGCTGCAGGAGATTTTCCAGAGGCTGTCTCCGAACACTATGGTGACGCCCCACAAGAAGAGCATGCTGGGAAATGGGAACTATG

ATGTGAATGTCATCATGGCAGCACTTCAAACCAAAGGCTATGAAGCTGTTTGGTGGGACAAGCGAAGGGACGTGGGTGTCATTGCTCTTACTAATGTCAT

GGGCTTCATCATGAACCTGCCCTCCAGCCTCTGCTGGGGTCCACTCAAGTTGCCTCTCAAAAGGCAGCACTGGATCTGTGTTCGTGAGGTGGGAGGGGCC

TACTACAACCTTGACTCCAAACTCAAGATGCCAGAGTGGATTGGAGGCGAGAGTGAGCTCAGGAAATTTCTAAAATACCATTTGCGAGGTAAAAACTGTG

AACTCCTACTGGTTGTACCGGAAGAAGTGGAAGCCCATCAGAGCTGGAGGGCCGACGTGTGACAGTTGTTTGACCCTCTTTGTCTCAACCCTCCAGACCT

CTTTGATGTGCTGTGGCCTCTACAGTCCACTTCCCCAAGCATCTCATTGGGTTTTCCCTTCAGATTTGCCAGTGCAATAGGACAGATGTGTGGACTGTCA

CAGAGCCACCCAGCAGTCTGTGCCTGGGGGAAGAAGGTAGGAGCTCTGAACACTTAGGGCAAGCCATTGAACCCTTTG - UNI31160 - CTATTTCA

GAGAGTCAGC
Translation
 - UNI31160 - 

For any suggestions or comments, please send an email to unitrap@crg.es