Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000074274 (D930028M14Rik)
Chromosomal location
Chr 7: 25937476 - 25941642 (+)
Description
RIKEN cDNA D930028M14 gene Gene [Source:MGI Symbol;Acc:MGI:3687343]
UniGene
Mm.59171 
MGI
MGI:3687343 
Uniprot/SPTREMBL
Q3UQ36 
Human Ortholog
not available
Omim not available
UniTrap UNI14695
Vector Insertion
Chr 7: 25937646 - 25940340
Public Clones CMHD-GT_537A6-5S (cmhd) CMHD-GT_537A6-3 (cmhd) FHCRC-GT-UAS-2G10 (fhcrc) IST13057A10 (tigm)
IST13767G7 (tigm) IST14345G7 (tigm) IST14734B11 (tigm)
Private Clones OST273817 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI16185
Vector Insertion
Chr 7: 25940640 - 25941112
Public Clones IST14345G7 (tigm) IST10740E12 (tigm)
Private Clones OST465434 (lexicon)
Severity of mutation (?) Insertion after 82% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000098678
Sequence
CTCTGCCTCTCTCTCCCTTGCTTCTCTTCCTTTCTTTCCCGGAGCCGCACCCAAGCCCCCACCCCATGTACCCCTTACCCCTACCTCTGGGGGGGGCCAG

CCATCACCCCATACTCCCCTACTGCAGGAGAGTTTAGGGGGGCTGAGAGCTTGGAGAGCCAGGAGAGGGG - UNI14695 - ACTCAAAGAAAGAGGA

AACACTCAGGAAGGGATGGAGAGATGGACAGAGCTGAATGCCTGTGGGAAGCACGGAGAGAAGCAGAGGACTATGGGAGGCCAGGAGCAGGAGACCTGTG

GGCCTGGTGAGCGGCACAGACCTCTGCACTCGGTGGGATTCCCAGCAGGCCTCGCTCCAAGCTCCCAGGGTTACTCTGAGGTCCGCCTATGTTGCGGATC

AGAGCTCTGAATTCTCAGCCTGCCTTAATTTGCTGTGGGACTGTCCAGGATTCCAGGGACTCACGGATCCTAGCCTGATAAAG - UNI16185 - TCA

CTGAAGACTCTGCCTCAAACGGTCCTGGGTTGTTCTTCCAAGTCACCTCCTTAGACCCAGCGATGCAAGGCTTGTCCCCCACAAGTGAGCTCCAGCTCCT

GAGATCTTCAGGGCTCCTGCACGGGGAGTATAGGAGTCTGTCCTCGTCGCCTCCGTGATGTAGCATGCGGAGGGCTACAGGGGACTGCAACTGGCCACGG

GGACTGCAAGGCCAGAGCTGCGTTCCTGGCTCCAACAGCTGATAAGCCTGTCACCGGTACCACATCCACAGTGAGACCTGTGTTGGCTTCTCGAGCCCTT

CAGGAACACCCTCCCAAAGATGTCCCGGAGGCCCTGTGTGTATCATCTAAACTCTGTCCTCTGACCACATTCTTTGCAGCCTCACACTTGGGCTGATAAC

ACTTGTGCCTGATCCCGGGGGTGCCTCTGAGGCCTCCGAAGTTCTCCTGCTTCTCGGCATCTCCAGGCCTCGTATGGGAGACATCCCAGGGTGGGGCAGG

GTGCTGCAGTAATAAATGGATGGATCT
Translation
 - UNI14695 - MPVGSTERSRGLWEARSRRPVGLVSGTDLCTRWDSQQASLQAPRVTLRSAYVADQSSEFSACLNLLWDCPGFQGLTDPSLIK - U

NI16185 - SLKTLPQTVLGCSSKSPP

For any suggestions or comments, please send an email to unitrap@crg.es