Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000078750 (AC105966.11)
Chromosomal location
Chr 3: 51256303 - 51292230 (-)
Description
not available
Human Ortholog
not available
Omim not available
UniTrap UNI31727
Vector Insertion
Chr 3: 51256302 - 51292231
Public Clones (sanger) IST11873G7 (tigm) IST14703F2 (tigm) IST14303C10 (tigm) IST14285E5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 31% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000108044
Sequence
ACTGTGTGTATGTTTATGTGTGTCTGT - UNI31727 - AATTAAAGACAGCTATGTTGTGTGCATGTGTGCCTGTTTCTGTGTGACCTGGTGCACAT

Translation
LCVCLCVSV - UNI31727 - VIKDSYVVCMCACFCVTWCT

For any suggestions or comments, please send an email to unitrap@crg.es