Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/gene.php on line 256
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000081660 (AL732617.24)
Chromosomal location
Chr 4: 3424125 - 3443662 (-)
Description
not available
Human Ortholog
not available
Omim not available
UniTrap UNI32766
Vector Insertion
Chr 4: 3425963 - 3433397
Public Clones IST13050E5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000121996
Sequence
ATGGGATGTATTAAATCAAAAAGGAAAGACAATCTCAATGATGATGAAGTAGATTCGAAGACTCAACCAGTAAGTAATACTGACCGAACTATTTATGTGA

GAGATCCAACGTCCAATAAACAGCAAAGGCCA GTTCCTGAATTTCATCTTTTACCAGGACAGAGATTTCAAATAAAAG ACCCAGAGGAGCAAGGTGAC

ATTGTGGTGGCCTTATACCCTTATGATGGCATCCACCCAGATGACTTGTCCTTCAAGAAAGGAGAAAAGATGAAAGTTCTGGAAGA GCATGGGGAATGG

TGGAAAGCCAAGTCCCTTTCATCAAAGAGAGAAGGCTTCATCCCCAGCAACTACGTGGCCAAGGTCAGCACCTTAGAAACTGAAGA GTGGTTCTTCAAG

GACATAACAAGGAAAGATGCAGAGCGACAGCTTCTGGCACGAGAGAACAGTGCAGGAGCTTTCCTTATCAGAGAAAGCGAAACTTTAAAGG GAAGCTTC

TCTCTTTCTGTCAGAGATTATGACCCTATGCATGGTGATGTCATTAAGCACTACAAAATTAGAAGTCTGGACAATGGTGGCTATTACATCTCTCCTCGCA

TCACTTTTCCCTGCATCAGTGACATGATTAAGCATTACCAAA - UNI32766 - AGCAGTCTGATGGTCTATGCAGAAGACTGGAGAAGCCATGCATC

AGTCCCAAACCTCAGAAGCCATGGGATAAAGATGCCTGGGAGTTCCCCCGGGAGTCCATTAAGTTGGTGAAAAAGCTTGGCACAGGGCAGTTTGGGGAAG

TCTGGATGG - UNI32766 - GTTACTATAACAACAGCACAAAGGTGGCTGTGAAGACCCTCAAGCCCGGCACCATGTCTGTGCAGGCATTCCTGGAA

GAGGCCAACCTCATGAAGACCTTGCAACATGACAAGCTAGTGCGGCTGTACGCTGTGGTCACCAAGGAGGAGCCCATCTACATCATCACCGAGTTCATGG

CTAAGG - UNI32766 - GTAGTTTGCTGGATTTCCTCAAGAGTGATGAAGGTGGCAAGGTGCTGCTGCCCAAGCTCATTGACTTCTCGGCCCAG
Translation
      - UNI32766 -  - UNI32766 -  - UNI32766 - 

For any suggestions or comments, please send an email to unitrap@crg.es