Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000081769 (RP23-303F24.3)
Chromosomal location
Chr 11: 53598991 - 53672758 (-)
Description
Novel protein  [Source:UniProtKB/TrEMBL;Acc:A8Y5C0]
UniGene
Mm.383772 
Uniprot/SPTREMBL
A8Y5C2 A8Y5C1 A8Y5C0 
Human Ortholog
not available
Omim not available
UniTrap UNI26216
Vector Insertion
Chr 11: 53663613 - 53672614
Public Clones not available
Private Clones OST130279 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI35791
Vector Insertion
Chr 11: 53627077 - 53663613
Public Clones IST10103A12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 31% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

UniTrap UNI17378
Vector Insertion
Chr 11: 53599852 - 53622760
Public Clones IST13084E3 (tigm) IST12942D12 (tigm)
Private Clones OST443751 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000121435
Sequence
GTTTTCGCTTTCGCTTTTGCTTTTAATAGCTTCTCCGAAGAGAAACAAAGCGGCGGCCACGACGGTCGACTGTCACGACGGGTGATGGGCTCGGAGGTGA

GGGGAGAGGAGAGCGGCCGCCTGAACCCCGGGCCCACAAGAGAG - UNI26216 - - UNI35792 - GTGGCAGCATGCCCCGGGCCTCCTTGTGA

TGTCAGGAGGCTGGACAGCCAAGAAAGAAGAAAATGGACTCCCTCCTTCTGAAGACTTGCCTGGAAGCCAGCCCCGA - UNI35792 - GTGCTGGAG

TGCACAGCGCCTCCAACGAGAACAGCTAAGAG - UNI35792 - AGGCAGGAAGCCCAAGATCAGATAGCCCTACCTCATATGGCTCTCATGCAGTAA

CATGAACAAGGTGGCAGTCAGCAGGACAGGGCTCGCTGAGGATTCCACAGAGCCAGTGATCTCAGAGTGACAGACCTTGTTCTAGACCCAGCAGCACTTC

CATGGGAAAATGCCTGGCGTCAGGCCCACAGGATGGCCTTCCTGCTCCACCACCCAAAGGCCTTCCCTTGCTAGCGTCTCCAGAGCTCCTCCATGGTGCT

CCAAAGTCAAGGAAGGCCTTGATCAGTTTAGTTCTAGACCAAAAGCTTACTAAAATGTCTCTCCTCCCTGCCCCCACTATGGTTCCCTGCTGAATCTCAG

TCTAATTGAC
Translation
 - UNI26216 - - UNI35792 - MDSLLLKTCLEASPE - UNI35792 - ECWSAQRLQREQLRE - UNI35792 - EAGSPRSDSPTSYGS

HAVT
Transcript ENSMUST00000120776
Sequence
GTTTTCGCTTTCGCTTTTGCTTTTAATAGCTTCTCCGAAGAGAAACAAAGCGGCGGCCACGACGGTCGACTGTCACGACGGGTGATGGGCTCGGAGGTGA

GGGGAGAGGAGAGCGGCCGCCTGAACCCCGGGCCCACAAGAGAG - UNI26216 - - UNI35792 - GTGGCAGCATGCCCCGGGCCTCCTTGTGA

TGTCAGGAGGCTGGACAGCCAAGAAAGAAGAAAATGGACTCCCTCCTTCTGAAGACTTGCCTGGAAGCCAGCCCCGA - UNI35792 - GTGCTGGAG

TGCACAGCGCCTCCAACGAGAACAGCTAAGAG - UNI35792 - TTGTGTTTGCCAATTGAAGACCCCAGCTGAAGATGAAGAGGAGTAGAGTCACCC

TGGGGTGCTTTCTGCCCCAGCTCCCCCCTTGCTCCGGCAGCACTGGCCTGCAGCTCTTAGGTTCCTGGCCACAGTTGGCTTCCTACTGTGGAGGTCCCTA

CTGGCTGCTCACTTTCCCTTTATATTTCTCTCAATGCTGCCTCCCCTCCCCTCCCCTCTTCATAAACAGGCTCTTCCTTAAACTCTTCTGTCCCTGGGTA

GCGGGAAGGGGTGGACCTGCTTCCTGCTGAGACTGACCCCGACAAGAAACATTTTCTGCTATGTCTCTAACATAGAATAAACAGTTCTCCAGCTGAGCCT

TAGGAGATGCTCATAGGAGCCCAGGCTTTGAGCTTTATAACACCCAAGCCACACAGTTGCTGCGACCGCTCTTCCCCTCCTTGCTTTTAACTATACTACA

AACAATGGAGGGGACCTGGTTAGTGATATCTCACCCAAGAATTTGGAGGGATAAATAAATAAACAGGTAACTGAAGAGAAA
Translation
 - UNI26216 - - UNI35792 - MDSLLLKTCLEASPE - UNI35792 - ECWSAQRLQREQLRV - UNI35792 - VVFAN
Transcript ENSMUST00000117316
Sequence
GTTTTCGCTTTCGCTTTTGCTTTTAATAGCTTCTCCGAAGAGAAACAAAGCGGCGGCCACGACGGTCGACTGTCACGACGGGTGATGGGCTCGGAGGTGA

GGGGAGAGGAGAGCGGCCGCCTGAACCCCGGGCCCACAAGAGAG - UNI26216 - - UNI35792 - GTGGCAGCATGCCCCGGGCCTCCTTGTGA

TGTCAGGAGGCTGGACAGCCAAGAAAGAAGAAAATGGACTCCCTCCTTCTGAAGACTTGCCTGGAAGCCAGCCCCGA - UNI35792 - GTGCTGGAG

TGCACAGCGCCTCCAACGAGAACAGCTAAGAG - UNI17378 - - UNI35792 - GTGTGTCAAGTTGACAACCAACATCGCTTCCACTTTGTGAA

TGAAGATGCTGAGGCCGCCAGTGGAGCCAGTAGCCTGGGTGAGGCCACACAGCTAGTTAAGCTAGTTATGCAGATCTGGTTGGTACCTAATGCAGTAACT

TCCTTTAAATGCCTTCCCCGAGCCACACTGGACCCCCCTAGCAAGGACAGCTAAGCACTGAAGACCAGTGAGTGTGACCACAGGCTTTACCCTGGAGAGT

CCTTAGCCAGGTCCTATAGGTTCTGTCTGGCTGTCCTGAGGGCCTCAGTTTACAGGCGCTCATCCAGAGACTGCTCAACCTTGGGCAGGTTCCCTATCGG

CGTGTCCTGCAGAGGCACTGTCCTTCTTGGCCTATCCCAGGCTTTGATTTTCCCAGATGGACAGGCTCTTTTACTAAACCTCTACACTCCCAGTGCTCCC

TGGGCCCTAGGACAGAGGAGATCCACAGGATCTTCTCCCTGGCCATCCCAGGGAGGGTTCATTTGAGAGGTAACATGTTTGTCCTGTGATTCTGACTCCA

ATCAAGGTCTAGGTCCTGGTACAGCTGCAGCCTCCCTTCTAGAAGCTTCTGAGGAGTGTCAGTTTCCTGTTGCCGCTGTAAGAGATGTCCTTGCACTTCG

TGGCCTAGACTAGCACACAGTTACAATTCTGAGGGGGCCAAGAGACAGAAGAGGTCCCGCAGGGCTATCCTCAGGGTGTATAGCAAACATGGGCTCTAGG

AAACAGCCTATGGGCAAGGCAGCACACACCTGTAACCCCAGCACTCAAAAGACTGAGCCAGAATGTTCTAAAGCCTAAGGCCAGTCTGGGCTATATATAG

AAGAATGAGTTTCCTGCCTC
Translation
 - UNI26216 - - UNI35792 - MDSLLLKTCLEASPE - UNI35792 - ECWSAQRLQREQLRG - UNI17378 - - UNI35792 - GV

SS

For any suggestions or comments, please send an email to unitrap@crg.es