Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/gene.php on line 256
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000082079 (AL833803.8)
Chromosomal location
Chr 2: 153522388 - 153555641 (+)
Description
not available
Human Ortholog
not available
Omim not available
UniTrap UNI9171
Vector Insertion
Chr 2: 153546240 - 153549217
Public Clones RRE122 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000119996
Sequence
ATGAGGGGAGGTAGCAGACACCTCAGTAATGAGGAGGATGTCAGTGGATGTGAGGACTGTATTATCATCAGTGGGACCTGCAGTGACCAGTCTTCAGACC

CCAAGACTGTTCCTTTGACCCAAGTCTTGGAGGCAGTCTGCACAGTGGAGAACAGAG GATGCAGAACAAGCTCACAACCATCCAAGAGGAAAGCATCCA

GCCTGATTAGTTACGTTCAG GACCTCACAGGAGATGGAGATGAAGATAGGGATGGTGAGGTGGGGGGCAGCAGTGGCTCTGGCACTCCAGTGATGCCCC

AACTCTTCTGTGAGACCAGGATACCCTCTAAAACCCCA CCCCTCAGTTGGCAAGCAAACACTTCAGCAAGCACGCCCTGGCTGTCCCCTGCCAGCCCTT

ACCCCATCATTGACCTCACAGATGAAGATGTGATACCCCAGAGCATCAGTACCCCATCGGTTGACTGGAGCCAGGACAGCCATCAGGAGGGCATGGATAC

CACACAGGTGGATGCAGAGAGCAGAGATGGAGGCAACATTGAGTATCAG GTCTCGGCTGACAAACTGTTGCTCAGCCAGTCCTGTATCCTGGCCGCCTT

CTATAAACTGGTTCCTTACAGGGAGTCTATATACCGTACTCTGGAG AAAGCCAGGGTGAGAGCTGGCAAGGCCTGCCCCAGCAGTCCTGGAGAGTCACT

GGAGGACCAGCTGAAGCCCATGCTGGAGTGGGCCCACGGTGGCTTCAAGCCCACTGGGATCGAGGGCCTCAAACCCAACAAGAAGCAACCAG AGAACAA

AAGTCGAAGACGCACAACCAATGACCCTGCTGCTTCTGAGTCCTCCCCACCCAAGCGCCTCAAGACAAATAGCTATGGCGGGAAGGACCGAGGGGAGGAT

GAGGAGAGCCGAG AACAGATGGCTTCTGATGTCACCAACAACAAGGGCAATCTGGAAG ACCACTGTTTGTCGTGCGGTAGGAAGGACCCTGTGTCCTT

CCACCCCCTCTTTGAGGGTGGGCTCTGTCAGAGTTGCCGG GACCGCTTCCTAGAGCTCTTCTACATGTATGACGAGGACGGCTATCAGTCCTACTGCAC

CGTGTGCTGTGAGGGCCGTGAACTGCTGCTGTGCAGTAACACAAGCTGCTGCAG ATGCTTCTGTGTGGAGTGTCTGGAGGTGCTGGTGGGTGCAGGCAC

AGCTGAGGATGTCAAGCTGCAGGAACCCTGGAGCTGCTATATGTGCCTCCCTCAGCGCTGCCATGGGGTCCTCCGACGCAGGAAAGATTGGAACATGCGC

CTGCAAGACTTCTTCACTACTGATCCTGACCTGGAAGAATTT GAGCCGCCCAAGTTGTACCCAGCGATTCCTGCAGCCAAAAGGAGGCCCATTAGAGTC

CTGTCTCTGTTTGATGGAATTGCAACAG GGTACTTGGTGCTCAAGGAGTTGGGTATTAAAGTGGAAAAGTACATTGCCTCCGAAGTCTGTGCAGAGTCC

ATCGCTGTGGGAACCGTTAAGCATGAAGGCCAAATCAAATATGTGGATGACATCAGGAACATTACAAAGGAACAT ATTGACGAGTGGGGCCCGTTCGAC

CTGGTGATTGGTGGAAGCCCCTGCAATGATCTTTCCTGTGTGAATCCTGTCAGGAAAGGCCTGTTTG AGGGTACTGGCCGGCTCTTCTTTGAGTTTTAC

CGATTGCTAAATTACTCATGCCCTGAGGAGGAGGATGACCGCCCCTTCTTCTGGATGTTTGAGAATGTGGTAGCTATGGAGGTCGGTGACAAGAGGGACA

TCTCACGATTCCTGGAG - UNI9171 - TGTAACCCAGTGATGATCGATGCCATCAAGGTGTCTGCTGCTCACAGGGCCCGGTACTTCTGGGGTAACC

TACCCGGAATGAACAG GCCCGTGATGGCTTCAAAGAATGATAAGCTCGAGCTGCAGGACTGCCTGGAGTTCAGTAGGACAGCAAAG TTAAAGAAAGTG

CAGACAATAACCACCAAGTCGAACTCCATCAGACAGGGCAAAAACCAGCTTTTCCCTGTAGTCATGAATGGCAAGGACGACGTTTTGTGGTGCACTGAGC

TCGAAAG GATCTTCGGCTTTCCTGAACACTACACAGACGTGTCCAACATGGGCCGTGGCGCCCGTCAGAAGCTGCTGGGCAGGTCTTGGAGTGTGCCAG

TCATCAGACACCTGTTTGCCCCCTTGAAGGACCACTTTGCCTGTGAAT
Translation
               - UNI9171 -    

For any suggestions or comments, please send an email to unitrap@crg.es