Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/gene.php on line 256
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

Gene ENSMUSG00000083294 (BX119993.9)
Chromosomal location
Chr X: 122736503 - 122777722 (-)
Description
not available
Human Ortholog
not available
Omim not available
UniTrap UNI30794
Vector Insertion
Chr X: 122736502 - 122770381
Public Clones IST13899B5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain
Proposed experimental design for vector insertion validation (?)

Show all transcripts and translations:
Transcript ENSMUST00000121069
Sequence
AACGGAACACTACTCGGCTACTAAAAACAAGGACATCTTGAAATTTGCAGTCAGATGCATGGAACGAGAAAAGGTCATCCTGGGTGATGTAAACCAGATC

CAGAAATACAAACATG - UNI30794 - TTTATCAGCAAGAGACTGCTAGAAATAGGACCCTTGCTGG - UNI30794 - TTTCCACATATTTGAT

GCCAGCATGGTCCTGCTAAACAAGTCTGCCAATCACCAAATAAGAGGTTTCACTTTAGCTACAATAGCATGCATAATGTGCAATACCTCTATGGCCCTTC

CAGAATGGCGAATTTGCTACTTGAACAACCCCATGCTTTCCTACCCAAGTTTGGCTTTTGTGAATATTTGGGAGGCCTACATCTGCCACCACAACCACAA

CTCAAGCCACCTGAGAGATTGCCATTACTACACCTGCCATAACAACCTTGTTCCTTTGGATATCCGGGTATCTCAAATTCTGCTCCTGGTTGCAAAAGTT

GTTGGTCTGGTTGGGACAGTTTGTTCTGTCTTTCGTCTACAGCAGTTATACACAGAGGAACTGCATAAGAATAATGACTACAATCCATTTGTTCTTTCAG

GTGTCCTCAATGCTATTGCTAGCACCTTTATTTTTCTTGCTGTTATGTGTAATCACCTCTCCGTGCCCAGCAAGGAAGAGGTATCTTTCCTGCAATCTTT

CCAAATGCCAATTTTTTCCAATGCTCAAAGAGCAGGCAGAGCCATGGGATTGGCATACATATCTGCCATATTGTTTTTATTAAGTGCTATAATTTTTATT

TCTTACTGTCCTTCAGTGGAAATCAAAATGTTTCCCCATGTCTGA
Translation
 - UNI30794 -  - UNI30794 - 

For any suggestions or comments, please send an email to unitrap@crg.es