Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI100
Trapped Gene
Rbm4 (ENSMUSG00000056951)
Vector Insertion
Chr 19: 4788043 - 4792397
Public Clones GC0024 (tigem) XC349 (baygenomics) CSH554 (baygenomics) HMA536 (baygenomics)
CSD015 (baygenomics) XE528 (baygenomics) CSJ099 (baygenomics) YHC064 (baygenomics)
F020A06 (ggtc) IST14841D11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000250851 (Chr19:4792398..4792820 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCACGGAGTGAACATCAAT Chr19:4792612..4792631 60.12 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000250851 (Chr19:4792398..4792820 -)
Downstram Exon
ENSMUSE00000250822 (Chr19:4787361..4788042 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCACGGAGTGAACATCAAT Chr19:4792612..4792631 60.12 45 TACGCACTGCTCCATATTGC Chr19:4787838..4787857 59.86 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000250866 Chr19:4793672..4793877 GCGGTGAGATACTCCACGTT Chr19:4793799..4793818 60.14 55
upstream ENSMUSE00000250851 Chr19:4792398..4792820 TGCACGGAGTGAACATCAAT Chr19:4792612..4792631 60.12 45

*** Putative Vector Insertion (Chr 19: 4788043 - 4792397) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000250822 Chr19:4787361..4788042 TACGCACTGCTCCATATTGC Chr19:4787838..4787857 59.86 50
downstream ENSMUSE00000622604 Chr19:4784299..4785567 CCCAAATCCAATACCCACTG Chr19:4785236..4785255 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr19:4789327..4789347 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATTGCGTGACTGGGAAAAC Chr19:4789331..4789351 59.98 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATGCCAGCGTAGTTGTTATGG Chr19:4789796..4789817 60.03 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCTTCCGTGACTGGGAAAAC Chr19:4789755..4789775 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000056951