Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1000
Trapped Gene
AC148089.8 (ENSMUSG00000059078)
Vector Insertion
Chr 8: 19785259 - 19785260
Public Clones AJ0513 (sanger) AS0826 (sanger) AZ0323 (sanger) DC0753 (sanger)
AJ0358 (sanger) CA0120 (sanger) CA0253 (sanger) AF0307 (sanger)
AE0874 (sanger) AW0361 (sanger) AY0008 (sanger) AE0873 (sanger)
AS0818 (sanger) XS1008 (sanger) AS0827 (sanger) AQ0865 (sanger)
AG0667 (sanger) AJ0360 (sanger) AY0059 (sanger) AF0408 (sanger)
AP0700 (sanger) RRJ371 (baygenomics) RRN236 (baygenomics) RRK112 (baygenomics)
RRJ610 (baygenomics) RRF234 (baygenomics) XL048 (baygenomics) RRU443 (baygenomics)
RRF425 (baygenomics) P113H01 (ggtc) M120C09 (ggtc) P091C04 (ggtc)
M122F07 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000473193 (Chr8:19784746..19785258 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCGAAGCTCACAGTTATCC Chr8:19784927..19784946 59.84 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000473193 (Chr8:19784746..19785258 +)
Downstram Exon
ENSMUSE00000555873 (Chr8:19785261..19785311 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCGAAGCTCACAGTTATCC Chr8:19784927..19784946 59.84 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000473193 Chr8:19784746..19785258 GCCGAAGCTCACAGTTATCC Chr8:19784927..19784946 59.84 55

*** Putative Vector Insertion (Chr 8: 19785259 - 19785260) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000555873 Chr8:19785261..19785311 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr8:19785261..19785281 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTGCGTGACTGGGAAAAC Chr8:19785257..19785277 61.69 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000059078