Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10003
Trapped Gene
Fbxl11 (ENSMUSG00000054611)
Vector Insertion
Chr 19: 4322551 - 4324336
Public Clones XE085 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000405455 (Chr19:4324337..4325046 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TACCTCAGCCGCAAAGAACT Chr19:4324376..4324395 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000405455 (Chr19:4324337..4325046 -)
Downstram Exon
ENSMUSE00000247321 (Chr19:4322387..4322550 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TACCTCAGCCGCAAAGAACT Chr19:4324376..4324395 60.01 50 CTGAGGTCGAGGCTTACTGG Chr19:4322418..4322437 60.01 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000707032 Chr19:4397934..4398266 TGCTACTGCTACCGGTTCCT Chr19:4398064..4398083 59.9 55
upstream ENSMUSE00000697145 Chr19:4396311..4397077 GACGCGGAGTCTGTAAAAGC Chr19:4396484..4396503 60.02 55
upstream ENSMUSE00000644473 Chr19:4394792..4394892 GGATTCGGTACAGCCAGAGA Chr19:4394795..4394814 60.22 55
upstream ENSMUSE00000697124 Chr19:4365785..4365802 No primer for this exon
upstream ENSMUSE00000697123 Chr19:4365157..4365180 No primer for this exon
upstream ENSMUSE00000492259 Chr19:4362776..4362914 CGTCGTCGCTATGAAGATGA Chr19:4362883..4362902 59.97 50
upstream ENSMUSE00000499673 Chr19:4361977..4362055 CAAGAATTCTGATGGACTTGGA Chr19:4361982..4362003 59.17 40.91
upstream ENSMUSE00000504496 Chr19:4361538..4361584 CCGGATCCAGACTTCACAGT Chr19:4361561..4361580 60.11 55
upstream ENSMUSE00000505490 Chr19:4356748..4356926 ATGGCACAATGGACACGATA Chr19:4356848..4356867 59.81 45
upstream ENSMUSE00000247776 Chr19:4352268..4352374 GCCAAGGCACTTGAAAGAAA Chr19:4352323..4352342 60.37 45
upstream ENSMUSE00000247754 Chr19:4351737..4351830 AATGAGTGTTCGAGGCTGCT Chr19:4351802..4351821 60.02 50
upstream ENSMUSE00000247736 Chr19:4350177..4350330 CACAACCTGGAGCTGTACGA Chr19:4350284..4350303 59.9 55
upstream ENSMUSE00000247717 Chr19:4348646..4348761 AGCATTGAAGATCGAACACG Chr19:4348647..4348666 58.88 45
upstream ENSMUSE00000247648 Chr19:4345518..4345644 ACTGCATAACCAACCGATCC Chr19:4345558..4345577 59.82 50
upstream ENSMUSE00000393203 Chr19:4342847..4343241 TGCATCTCACCCATTTTGAA Chr19:4342955..4342974 60.05 40
upstream ENSMUSE00000247594 Chr19:4331186..4331269 GAACTTGCCAGTAGCGATCC Chr19:4331238..4331257 59.84 55
upstream ENSMUSE00000247451 Chr19:4328953..4329222 AATCCTGTGTCCTCCGACAG Chr19:4328962..4328981 60.11 55
upstream ENSMUSE00000247425 Chr19:4328128..4328259 GCTGCATCTGCAACGAGATA Chr19:4328149..4328168 60.13 50
upstream ENSMUSE00000487092 Chr19:4326809..4326898 GGAAGACAGCTCGGACAAAG Chr19:4326814..4326833 59.99 55
upstream ENSMUSE00000405455 Chr19:4324337..4325046 TACCTCAGCCGCAAAGAACT Chr19:4324376..4324395 60.01 50

*** Putative Vector Insertion (Chr 19: 4322551 - 4324336) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000247321 Chr19:4322387..4322550 CTGAGGTCGAGGCTTACTGG Chr19:4322418..4322437 60.01 60
downstream ENSMUSE00000247290 Chr19:4320898..4321056 CGAAGATCAAGGGTCCTGAG Chr19:4320941..4320960 59.8 55
downstream ENSMUSE00000338144 Chr19:4320152..4320367 GGAAGACCCGACAGCAGTTA Chr19:4320164..4320183 60.26 55
downstream ENSMUSE00000707031 Chr19:4317822..4319281 GCAGGCAATAACCTTGGTGT Chr19:4318897..4318916 60 50
downstream ENSMUSE00000323076 Chr19:4316170..4319281 GCAGGCAATAACCTTGGTGT Chr19:4318897..4318916 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr19:4324266..4324286 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAAATGGTGAGCAGGGATGC Chr19:4324321..4324341 61 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054611