Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10007
Trapped Gene
Gin1 (ENSMUSG00000026333)
Vector Insertion
Chr 1: 99682836 - 99688873
Public Clones XE095 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 83% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000158135 (Chr1:99682553..99682835 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGAACCAGACTCAAACGAC Chr1:99682765..99682784 59.56 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000158135 (Chr1:99682553..99682835 +)
Downstram Exon
ENSMUSE00000693395 (Chr1:99688874..99689342 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGAACCAGACTCAAACGAC Chr1:99682765..99682784 59.56 55 GTCGTGATCTGCCACTATCG Chr1:99688920..99688939 59.27 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000706938 Chr1:99666745..99666832 AACCTGCCGTTTGCACTTAG Chr1:99666803..99666822 60.31 50
upstream ENSMUSE00000693398 Chr1:99666756..99666832 AACCTGCCGTTTGCACTTAG Chr1:99666803..99666822 60.31 50
upstream ENSMUSE00000597881 Chr1:99666774..99666832 AACCTGCCGTTTGCACTTAG Chr1:99666803..99666822 60.31 50
upstream ENSMUSE00000158134 Chr1:99672024..99672169 TAAGCGCACAGGGGAATATC Chr1:99672084..99672103 60.06 50
upstream ENSMUSE00000709792 Chr1:99672024..99672169 TAAGCGCACAGGGGAATATC Chr1:99672084..99672103 60.06 50
upstream ENSMUSE00000158130 Chr1:99673903..99674096 ACTACTGGACGTCCGTGACC Chr1:99674059..99674078 60.03 60
upstream ENSMUSE00000693388 Chr1:99673903..99674716 ACTACTGGACGTCCGTGACC Chr1:99674059..99674078 60.03 60
upstream ENSMUSE00000693397 Chr1:99679504..99679809 GGGACCTTTCCATACAAGCA Chr1:99679614..99679633 59.93 50
upstream ENSMUSE00000659722 Chr1:99679771..99679809 No primer for this exon
upstream ENSMUSE00000158132 Chr1:99681330..99681521 TTCTCGTGCTTCTGGAAGTG Chr1:99681377..99681396 59.16 50
upstream ENSMUSE00000283355 Chr1:99681632..99681799 GCGATTAGAGAGGCTGATGG Chr1:99681746..99681765 59.94 55
upstream ENSMUSE00000158135 Chr1:99682553..99682835 GGGAACCAGACTCAAACGAC Chr1:99682765..99682784 59.56 55

*** Putative Vector Insertion (Chr 1: 99682836 - 99688873) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000158129 Chr1:99688874..99690286 CGTGATCTGCCACTATCGAA Chr1:99688918..99688937 59.82 50
downstream ENSMUSE00000693395 Chr1:99688874..99689342 GTCGTGATCTGCCACTATCG Chr1:99688920..99688939 59.27 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAAATGTCCCACCTTAGGC Chr1:99682790..99682810 59.43 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGAGAGAGTCCAGTGAGCA Chr1:99688814..99688835 59.75 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026333