Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10016
Trapped Gene
Ctbp1 (ENSMUSG00000037373)
Vector Insertion
Chr 5: 33593722 - 33601786
Public Clones XE153 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000245962 (Chr5:33601787..33601993 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACCTGTACCGACGAACCAC Chr5:33601903..33601922 59.89 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000245962 (Chr5:33601787..33601993 -)
Downstram Exon
ENSMUSE00000548489 (Chr5:33593507..33593721 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACCTGTACCGACGAACCAC Chr5:33601903..33601922 59.89 55 AAGAGGACGTTGAAGCCAAA Chr5:33593642..33593661 59.85 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000401517 Chr5:33617428..33617610 CAGCTCCCACTTGCTCAACA Chr5:33617443..33617462 62.55 55
upstream ENSMUSE00000245992 Chr5:33609532..33609686 TCCACACAGGAGATCCATGA Chr5:33609536..33609555 60.05 50
upstream ENSMUSE00000548492 Chr5:33603658..33603802 GCAGCGGGTTTGACAATATC Chr5:33603683..33603702 60.48 50
upstream ENSMUSE00000245962 Chr5:33601787..33601993 AACCTGTACCGACGAACCAC Chr5:33601903..33601922 59.89 55

*** Putative Vector Insertion (Chr 5: 33593722 - 33601786) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000548489 Chr5:33593507..33593721 AAGAGGACGTTGAAGCCAAA Chr5:33593642..33593661 59.85 45
downstream ENSMUSE00000548486 Chr5:33593020..33593150 AGTGCCTTCTCATCCACCAG Chr5:33593067..33593086 60.26 55
downstream ENSMUSE00000548483 Chr5:33592236..33592363 CCTTTAAGGGTCCCTGGCTA Chr5:33592319..33592338 60.44 55
downstream ENSMUSE00000245917 Chr5:33591756..33591873 AGGTGGTCCTTGTTGACACA Chr5:33591806..33591825 58.99 50
downstream ENSMUSE00000519742 Chr5:33590403..33591335 TTAAACGAGGAACGCAAAGG Chr5:33590908..33590927 60.24 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAGACCTTGGGCATCATTG Chr5:33601791..33601811 60.07 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGACCTTGGGCATCATTG Chr5:33601791..33601811 60.07 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037373