Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10023
Trapped Gene
Phrf1 (ENSMUSG00000038611)
Vector Insertion
Chr 7: 148418317 - 148418441
Public Clones XC260 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000668318 (Chr7:148418318..148418440 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGAGGGGCTGTCTGAAGAG Chr7:148418399..148418418 60.13 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000668318 (Chr7:148418318..148418440 +)
Downstram Exon
ENSMUSE00000668329 (Chr7:148418318..148418440 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGAGGGGCTGTCTGAAGAG Chr7:148418399..148418418 60.13 60 TCTTCAGACAGCCCCTCTGT Chr7:148418420..148418439 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000668320 Chr7:148414683..148414790 GACAGAGGCGGGATCGTCTA Chr7:148414742..148414761 62.65 60
upstream ENSMUSE00000668331 Chr7:148414687..148414790 GACAGAGGCGGGATCGTCTA Chr7:148414742..148414761 62.65 60
upstream ENSMUSE00000713133 Chr7:148417126..148417241 CATGGATGACGACAACTTGG Chr7:148417147..148417166 59.96 50
upstream ENSMUSE00000719095 Chr7:148417126..148417241 CATGGATGACGACAACTTGG Chr7:148417147..148417166 59.96 50

*** Putative Vector Insertion (Chr 7: 148418317 - 148418441) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000668318 Chr7:148418318..148418440 TCTTCAGACAGCCCCTCTGT Chr7:148418420..148418439 59.99 55
downstream ENSMUSE00000668329 Chr7:148418318..148418440 TCTTCAGACAGCCCCTCTGT Chr7:148418420..148418439 59.99 55
downstream ENSMUSE00000668317 Chr7:148423396..148423601 CATTCGATGATGCAATCCAG Chr7:148423597..148423616 60.03 45
downstream ENSMUSE00000668328 Chr7:148423396..148423601 CATTCGATGATGCAATCCAG Chr7:148423597..148423616 60.03 45
downstream ENSMUSE00000668316 Chr7:148426784..148426867 TGTTCGATCAACAGGACAGG Chr7:148426816..148426835 59.68 50
downstream ENSMUSE00000668327 Chr7:148426784..148426867 TGTTCGATCAACAGGACAGG Chr7:148426816..148426835 59.68 50
downstream ENSMUSE00000711638 Chr7:148429398..148429795 AAAGTCGGGTCTTCCTCCTC Chr7:148429732..148429751 59.68 55
downstream ENSMUSE00000668315 Chr7:148429677..148429795 AAAGTCGGGTCTTCCTCCTC Chr7:148429732..148429751 59.68 55
downstream ENSMUSE00000668326 Chr7:148429677..148429795 AAAGTCGGGTCTTCCTCCTC Chr7:148429732..148429751 59.68 55
downstream ENSMUSE00000668325 Chr7:148432746..148432843 CACCAGGGACCGTACACTCT Chr7:148432831..148432850 60.03 60
downstream ENSMUSE00000668324 Chr7:148433120..148433295 CAGCCAGTAGCAAGGAGACC Chr7:148433167..148433186 60.01 60
downstream ENSMUSE00000668323 Chr7:148434279..148434408 GTGTCAAGGGACGCTGGTAT Chr7:148434378..148434397 60 55
downstream ENSMUSE00000668322 Chr7:148440763..148440890 CAGATGACCTGGACCGAGTT Chr7:148440816..148440835 60.11 55
downstream ENSMUSE00000668321 Chr7:148442397..148442578 AGGCCTAGTGTTCGTGCAAT Chr7:148442443..148442462 59.76 50
downstream ENSMUSE00000586970 Chr7:148442702..148442821 GGGACAGCACTCTCCTCTTG Chr7:148442766..148442785 59.99 60
downstream ENSMUSE00000586969 Chr7:148443243..148443397 CCCGGTGTATGACAACATCA Chr7:148443373..148443392 60.24 50
downstream ENSMUSE00000521490 Chr7:148443931..148446606 GCCGGAACGTGTTACAGAAT Chr7:148444722..148444741 60 50
downstream ENSMUSE00000232784 Chr7:148446859..148447013 AATCCTATGAGGGCCCTGTC Chr7:148446934..148446953 60.29 55
downstream ENSMUSE00000586968 Chr7:148447112..148447441 CATGTTGGGGCTGTAAACCT Chr7:148447207..148447226 59.85 50
downstream ENSMUSE00000513073 Chr7:148447675..148447803 AAGGGTTTAATGGCCAGCTT Chr7:148447742..148447761 59.97 45
downstream ENSMUSE00000393869 Chr7:148448308..148448650 GTGGCTAGCCTCAGGTCTCA Chr7:148448464..148448483 60.56 60
downstream ENSMUSE00000713427 Chr7:148448308..148448494 TCTGCGCATATGCCTGTATT Chr7:148448400..148448419 59.31 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGATGATACAGGCAGCGTGA Chr7:148418353..148418373 59.42 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038611