Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10036
Trapped Gene
Epb4.1l5 (ENSMUSG00000026383)
Vector Insertion
Chr 1: 121501833 - 121504563
Public Clones XC282 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 76% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000158594 (Chr1:121504564..121504670 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGCCTAGCAAGCGGTATT Chr1:121504588..121504607 60.24 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000158594 (Chr1:121504564..121504670 -)
Downstram Exon
ENSMUSE00000158597 (Chr1:121501805..121501832 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGCCTAGCAAGCGGTATT Chr1:121504588..121504607 60.24 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000339654 Chr1:121545362..121545513 GACCCGTCCTCTCCTCTAGC Chr1:121545444..121545463 60.36 65
upstream ENSMUSE00000597440 Chr1:121539054..121539235 CCAAGTCCATCATCACATGC Chr1:121539099..121539118 59.92 50
upstream ENSMUSE00000158599 Chr1:121530122..121530226 TTCATGGATTCAGCCCAAGT Chr1:121530126..121530145 60.46 45
upstream ENSMUSE00000158603 Chr1:121520503..121520545 TGGATGGTACAAAAAGCATCA Chr1:121520518..121520538 59.03 38.1
upstream ENSMUSE00000158602 Chr1:121518463..121518541 CGGAACCAAATAATCTTCGTG Chr1:121518476..121518496 59.46 42.86
upstream ENSMUSE00000158590 Chr1:121517252..121517296 No primer for this exon
upstream ENSMUSE00000158592 Chr1:121516744..121516796 AGCAGTTCAGTTGGCAGCTT Chr1:121516756..121516775 60.2 50
upstream ENSMUSE00000158589 Chr1:121514131..121514251 TGGCGACTATGATCTTGCTG Chr1:121514225..121514244 59.97 50
upstream ENSMUSE00000158596 Chr1:121513941..121514028 GGTGTTGATATGCACGTGGT Chr1:121513945..121513964 59.3 50
upstream ENSMUSE00000225091 Chr1:121512978..121513066 TTGGGACTGACTCCAACAGG Chr1:121513023..121513042 61.1 55
upstream ENSMUSE00000540299 Chr1:121511923..121511992 No primer for this exon
upstream ENSMUSE00000158593 Chr1:121505694..121505863 CCCATCGATCAGGATTCATT Chr1:121505720..121505739 59.71 45
upstream ENSMUSE00000158594 Chr1:121504564..121504670 AAGGCCTAGCAAGCGGTATT Chr1:121504588..121504607 60.24 50

*** Putative Vector Insertion (Chr 1: 121501833 - 121504563) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000158597 Chr1:121501805..121501832 No primer for this exon
downstream ENSMUSE00000158591 Chr1:121496775..121496814 CTTTTCTGAGCGGAAGCATT Chr1:121496766..121496785 59.59 45
downstream ENSMUSE00000225055 Chr1:121495582..121495697 ATTTCCTGTCGTGCTGCTCT Chr1:121495561..121495580 60.02 50
downstream ENSMUSE00000373909 Chr1:121492456..121492636 GGCTCCTGCATTCTTCACAT Chr1:121492482..121492501 60.23 50
downstream ENSMUSE00000436346 Chr1:121475491..121475654 GAGCAAATCAACGCTTAGGG Chr1:121475608..121475627 59.85 50
downstream ENSMUSE00000436338 Chr1:121469383..121469480 AGGTCGAAGAGATGGCAAGA Chr1:121469388..121469407 59.95 50
downstream ENSMUSE00000436326 Chr1:121466622..121466750 CATTCAATGCTGGGTTCTCA Chr1:121466665..121466684 59.65 45
downstream ENSMUSE00000436318 Chr1:121464373..121464437 TGAACGCTGGCATTTTTATG Chr1:121464369..121464388 59.7 40
downstream ENSMUSE00000436312 Chr1:121451629..121451719 ACAGACGGGCACATCATTTT Chr1:121451664..121451683 60.38 45
downstream ENSMUSE00000436306 Chr1:121450783..121450857 AAGGCGTCCAGTTCATCAGT Chr1:121450810..121450829 59.73 50
downstream ENSMUSE00000436304 Chr1:121447099..121447140 TGATCATGGATGGTGAAGACA Chr1:121447097..121447117 59.91 42.86
downstream ENSMUSE00000436297 Chr1:121446464..121446594 ATGCTCCATATCCTGCAAGC Chr1:121446530..121446549 60.21 50
downstream ENSMUSE00000436292 Chr1:121444708..121445772 GACTTCCAGTTGGACGGAAA Chr1:121445532..121445551 60.09 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGTCCTTCCTTCCTGGACA Chr1:121504516..121504536 60.62 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCCTTCCTGGACAGTCTCG Chr1:121504510..121504530 60.38 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026383