Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10042
Trapped Gene
Dync1li1 (ENSMUSG00000032435)
Vector Insertion
Chr 9: 114629788 - 114630822
Public Clones XC334 (baygenomics) A053B03 (ggtc) PST5175-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 83% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000219723 (Chr9:114629667..114629787 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCTCGAACACCAAACAGAT Chr9:114629696..114629715 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000219723 (Chr9:114629667..114629787 +)
Downstram Exon
ENSMUSE00000219726 (Chr9:114630823..114630975 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCTCGAACACCAAACAGAT Chr9:114629696..114629715 59.97 50 GTTGAAGAAATTCGCCAGGA Chr9:114630866..114630885 60.19 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000353227 Chr9:114597908..114598145 CTCGTTCGGTTCATCTCCAC Chr9:114598023..114598042 60.66 55
upstream ENSMUSE00000329967 Chr9:114598327..114598400 ATCCTCAGCGAGGTCTCCAC Chr9:114598334..114598353 61.76 60
upstream ENSMUSE00000329943 Chr9:114614172..114614288 AATGTGCACGACGAAGACAG Chr9:114614264..114614283 59.9 50
upstream ENSMUSE00000329919 Chr9:114615125..114615355 TGGACTGCTTTGGATTCCTT Chr9:114615253..114615272 59.67 45
upstream ENSMUSE00000329887 Chr9:114618263..114618432 AAGAGTACGTGGAGCCAGGA Chr9:114618278..114618297 59.87 55
upstream ENSMUSE00000329856 Chr9:114622628..114622721 TCTCACATCCGCAAGTTCTG Chr9:114622694..114622713 59.98 50
upstream ENSMUSE00000219724 Chr9:114624212..114624347 GCAGCGCTGATTTACACTTC Chr9:114624217..114624236 58.68 50
upstream ENSMUSE00000219725 Chr9:114624718..114624829 CAGCAGGGTGGGATAATGATA Chr9:114624720..114624740 59.79 47.62
upstream ENSMUSE00000219728 Chr9:114626981..114627040 CGTGCATGAGAAGGAGATCA Chr9:114626983..114627002 59.94 50
upstream ENSMUSE00000329634 Chr9:114628976..114629020 AGCAAAGCAACCTCCAACTG Chr9:114628984..114629003 60.43 50
upstream ENSMUSE00000219723 Chr9:114629667..114629787 CCCTCGAACACCAAACAGAT Chr9:114629696..114629715 59.97 50

*** Putative Vector Insertion (Chr 9: 114629788 - 114630822) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000219726 Chr9:114630823..114630975 GTTGAAGAAATTCGCCAGGA Chr9:114630866..114630885 60.19 45
downstream ENSMUSE00000505284 Chr9:114632371..114633420 GAAGCAGGTTTCCGTGTGAT Chr9:114632437..114632456 60.12 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATCCATCGTGACTGGGAAA Chr9:114629832..114629852 60.32 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032435