Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10044
Trapped Gene
Rab23 (ENSMUSG00000004768)
Vector Insertion
Chr 1: 33795226 - 33796097
Public Clones XC337 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 81% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000313979 (Chr1:33795133..33795225 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000313979 (Chr1:33795133..33795225 +)
Downstram Exon
ENSMUSE00000701944 (Chr1:33796098..33797554 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000466360 Chr1:33776741..33777018 No primer for this exon
upstream ENSMUSE00000701946 Chr1:33777253..33777429 No primer for this exon
upstream ENSMUSE00000314015 Chr1:33778453..33778544 No primer for this exon
upstream ENSMUSE00000314006 Chr1:33780631..33780850 No primer for this exon
upstream ENSMUSE00000713170 Chr1:33780631..33780850 No primer for this exon
upstream ENSMUSE00000156128 Chr1:33781779..33781864 No primer for this exon
upstream ENSMUSE00000156133 Chr1:33791547..33791703 No primer for this exon
upstream ENSMUSE00000551308 Chr1:33793645..33793727 No primer for this exon
upstream ENSMUSE00000313979 Chr1:33795133..33795225 No primer for this exon

*** Putative Vector Insertion (Chr 1: 33795226 - 33796097) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000551300 Chr1:33796098..33798342 No primer for this exon
downstream ENSMUSE00000701944 Chr1:33796098..33797554 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCGAAGATCCAGAACAGACA Chr1:33795185..33795205 58.8 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGAAGATCCAGAACAGACA Chr1:33795185..33795205 58.8 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004768