Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10047
Trapped Gene
Fip1l1 (ENSMUSG00000029227)
Vector Insertion
Chr 5: 74942186 - 74942719
Public Clones XC347 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 33% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000187135 (Chr5:74942078..74942185 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCAAAGGAGTGGACCTCGAT Chr5:74942087..74942106 59.65 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000187135 (Chr5:74942078..74942185 +)
Downstram Exon
ENSMUSE00000187128 (Chr5:74942720..74942850 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCAAAGGAGTGGACCTCGAT Chr5:74942087..74942106 59.65 50 TTCCAGTCCCATTCGTATCC Chr5:74942817..74942836 59.75 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696091 Chr5:74931507..74931786 ATTTGAGTCTCGCGCTCTTC Chr5:74931574..74931593 59.72 50
upstream ENSMUSE00000714231 Chr5:74931507..74931786 ATTTGAGTCTCGCGCTCTTC Chr5:74931574..74931593 59.72 50
upstream ENSMUSE00000708936 Chr5:74931510..74931786 ATTTGAGTCTCGCGCTCTTC Chr5:74931574..74931593 59.72 50
upstream ENSMUSE00000711251 Chr5:74931518..74931786 ATTTGAGTCTCGCGCTCTTC Chr5:74931574..74931593 59.72 50
upstream ENSMUSE00000520807 Chr5:74931542..74931786 ATTTGAGTCTCGCGCTCTTC Chr5:74931574..74931593 59.72 50
upstream ENSMUSE00000716815 Chr5:74931573..74931786 ATTTGAGTCTCGCGCTCTTC Chr5:74931574..74931593 59.72 50
upstream ENSMUSE00000187123 Chr5:74932826..74932870 CACAGTGACTTGGCAAAGGAT Chr5:74932846..74932866 60.16 47.62
upstream ENSMUSE00000187130 Chr5:74932967..74933006 TGAAGTTGAAAGGCCAGAAGA Chr5:74932974..74932994 59.98 42.86
upstream ENSMUSE00000187119 Chr5:74936957..74937014 GCTAATCCTCCATCTGGAATTG Chr5:74936958..74936979 59.93 45.46
upstream ENSMUSE00000187116 Chr5:74938034..74938137 TCAAAACAGGAGCACCACAG Chr5:74938113..74938132 59.87 50
upstream ENSMUSE00000187122 Chr5:74941437..74941501 AATATCAAGGCAGGGGGAAG Chr5:74941465..74941484 60.28 50
upstream ENSMUSE00000187135 Chr5:74942078..74942185 TCAAAGGAGTGGACCTCGAT Chr5:74942087..74942106 59.65 50

*** Putative Vector Insertion (Chr 5: 74942186 - 74942719) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000187128 Chr5:74942720..74942850 TTCCAGTCCCATTCGTATCC Chr5:74942817..74942836 59.75 50
downstream ENSMUSE00000695986 Chr5:74943132..74943200 GCCATCTTGGATCTCTGCAC Chr5:74943185..74943204 60.78 55
downstream ENSMUSE00000187127 Chr5:74953065..74953174 AACAATGATGGCGGAGAAGT Chr5:74953153..74953172 59.56 45
downstream ENSMUSE00000696051 Chr5:74960544..74960651 CACTTCCCAACGCTTGAACT Chr5:74960615..74960634 60.29 50
downstream ENSMUSE00000227576 Chr5:74967124..74967217 CACTCGGCTGATGGTTATTG Chr5:74967181..74967200 59.15 50
downstream ENSMUSE00000187125 Chr5:74968454..74968610 AAAATGGAGGTGGTTTGCTG Chr5:74968517..74968536 59.97 45
downstream ENSMUSE00000500304 Chr5:74981071..74981097 TGGAGGTGGTACAGTTATTGGA Chr5:74981097..74981118 59.35 45.46
downstream ENSMUSE00000187129 Chr5:74983028..74983082 No primer for this exon
downstream ENSMUSE00000187120 Chr5:74984170..74984225 GTGCAGAACGGCTGTCATAC Chr5:74984207..74984226 59.32 55
downstream ENSMUSE00000468092 Chr5:74987799..74988018 TAGTCCCACTGCTTGGTGGT Chr5:74987874..74987893 60.57 55
downstream ENSMUSE00000695985 Chr5:74987799..74988043 CACCCAACAAACCTGTTGAA Chr5:74988033..74988052 59.44 45
downstream ENSMUSE00000227531 Chr5:74991099..74991236 CTCTGTGCCGCTCTTCTTTC Chr5:74991190..74991209 60.28 55
downstream ENSMUSE00000227527 Chr5:74991864..74993149 CTAAATGGCGGAGGATTTCA Chr5:74992968..74992987 60.03 45
downstream ENSMUSE00000695992 Chr5:74991864..74992173 CACTTTCATGGCGACGTCTA Chr5:74991892..74991911 59.86 50
downstream ENSMUSE00000715540 Chr5:74991864..74992231 CACTTTCATGGCGACGTCTA Chr5:74991892..74991911 59.86 50
downstream ENSMUSE00000718209 Chr5:74991864..74992144 CACTTTCATGGCGACGTCTA Chr5:74991892..74991911 59.86 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGAGCAGCTAATCGCCTTG Chr5:74942228..74942248 61.07 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTATTTGTGAGCAGCCGTGA Chr5:74942222..74942242 59.87 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029227