Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10077
Trapped Gene
Srpr (ENSMUSG00000032042)
Vector Insertion
Chr 9: 35018991 - 35019576
Public Clones (sanger) XC686 (baygenomics)
Private Clones OST373421 (lexicon) OST189467 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000385996 (Chr9:35018788..35018990 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGTTGATTCGTTCCGTACT Chr9:35018964..35018983 60.14 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000385996 (Chr9:35018788..35018990 +)
Downstram Exon
ENSMUSE00000216018 (Chr9:35019577..35019660 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGTTGATTCGTTCCGTACT Chr9:35018964..35018983 60.14 50 CAGCTCAAACTGGTTGTCCA Chr9:35019654..35019673 59.87 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000385996 Chr9:35018788..35018990 GCGTTGATTCGTTCCGTACT Chr9:35018964..35018983 60.14 50

*** Putative Vector Insertion (Chr 9: 35018991 - 35019576) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000216018 Chr9:35019577..35019660 CAGCTCAAACTGGTTGTCCA Chr9:35019654..35019673 59.87 50
downstream ENSMUSE00000479857 Chr9:35019933..35020096 TGCGATACTTATCCCGGAAC Chr9:35020020..35020039 59.92 50
downstream ENSMUSE00000229969 Chr9:35020305..35020465 GGAGCACGGATCTTACTGCT Chr9:35020340..35020359 59.46 55
downstream ENSMUSE00000229951 Chr9:35020715..35020871 AGCCAAAGTGCCATCAGAAC Chr9:35020737..35020756 60.26 50
downstream ENSMUSE00000229904 Chr9:35020968..35021121 ACAGCCACCTAGTTCCCACA Chr9:35021043..35021062 60.57 55
downstream ENSMUSE00000216024 Chr9:35021332..35021420 TCATCTGAGCTGCTGCAATC Chr9:35021393..35021412 60.26 50
downstream ENSMUSE00000216019 Chr9:35021522..35021640 AAACATGCCACCCAGAGTTC Chr9:35021555..35021574 59.97 50
downstream ENSMUSE00000216022 Chr9:35021772..35021858 AGAGCTGGACAGCAATGTCA Chr9:35021810..35021829 59.58 50
downstream ENSMUSE00000216013 Chr9:35022145..35022317 ACGCTGTGGCTGTAGGATCT Chr9:35022212..35022231 59.9 55
downstream ENSMUSE00000216017 Chr9:35022403..35022616 AGCCCGAAATGTATCACAGG Chr9:35022471..35022490 59.96 50
downstream ENSMUSE00000216023 Chr9:35023052..35023215 GCCTACTAAGGCCTCCCCTA Chr9:35023197..35023216 59.7 60
downstream ENSMUSE00000216015 Chr9:35023300..35023398 ATCAATGAGCCGAGGTGTCT Chr9:35023362..35023381 59.69 50
downstream ENSMUSE00000536930 Chr9:35023523..35024588 CAAAGACGATGGGTTTGCTT Chr9:35023577..35023596 60.11 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTCAGACCCAGATAATCG Chr9:35019028..35019048 59.5 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGACGTGACTGGGAAAACC Chr9:35019038..35019058 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032042