Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10091
Trapped Gene
Acvr1b (ENSMUSG00000000532)
Vector Insertion
Chr 15: 101032577 - 101033368
Public Clones XE242 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 65% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000132937 (Chr15:101032409..101032576 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000132937 (Chr15:101032409..101032576 +)
Downstram Exon
ENSMUSE00000132941 (Chr15:101033369..101033525 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000486950 Chr15:101004535..101004666 No primer for this exon
upstream ENSMUSE00000290064 Chr15:101024363..101024602 No primer for this exon
upstream ENSMUSE00000132935 Chr15:101025240..101025488 No primer for this exon
upstream ENSMUSE00000132934 Chr15:101029215..101029445 No primer for this exon
upstream ENSMUSE00000132937 Chr15:101032409..101032576 No primer for this exon

*** Putative Vector Insertion (Chr 15: 101032577 - 101033368) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000132941 Chr15:101033369..101033525 No primer for this exon
downstream ENSMUSE00000132936 Chr15:101034884..101035008 No primer for this exon
downstream ENSMUSE00000132938 Chr15:101039511..101039641 No primer for this exon
downstream ENSMUSE00000620786 Chr15:101041168..101044109 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTGCATATGGAGATTGTGG Chr15:101032549..101032569 58.95 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTGCATATGGAGATTGTGG Chr15:101032549..101032569 58.95 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000532