Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10093
Trapped Gene
5830415F09Rik (ENSMUSG00000028331)
Vector Insertion
Chr 4: 46393183 - 46394930
Public Clones XE780 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 80% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000178228 (Chr4:46394931..46395557 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCTCCTGTAGCCCCTTTAC Chr4:46394985..46395004 60.1 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000178228 (Chr4:46394931..46395557 -)
Downstram Exon
ENSMUSE00000344162 (Chr4:46392736..46393182 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCTCCTGTAGCCCCTTTAC Chr4:46394985..46395004 60.1 60 CAGCCACCTGAACAGACTCA Chr4:46392936..46392955 60.02 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000178227 Chr4:46402190..46402309 ACTCAGCGGCCTGTAACCAT Chr4:46402264..46402283 61.99 55
upstream ENSMUSE00000632758 Chr4:46402190..46402295 ACTCAGCGGCCTGTAACCAT Chr4:46402264..46402283 61.99 55
upstream ENSMUSE00000178226 Chr4:46400440..46400614 CATTCCTTGATGGGCCTAGA Chr4:46400458..46400477 60.03 50
upstream ENSMUSE00000178225 Chr4:46398966..46399123 CAAGCTGGAGAAGGTGGAAG Chr4:46398966..46398985 59.98 55
upstream ENSMUSE00000178228 Chr4:46394931..46395557 GGCTCCTGTAGCCCCTTTAC Chr4:46394985..46395004 60.1 60

*** Putative Vector Insertion (Chr 4: 46393183 - 46394930) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000632755 Chr4:46392965..46393182 GAAGAAGAAAAGGCGGTCCT Chr4:46393030..46393049 59.83 50
downstream ENSMUSE00000344162 Chr4:46392736..46393182 CAGCCACCTGAACAGACTCA Chr4:46392936..46392955 60.02 55
downstream ENSMUSE00000632753 Chr4:46389847..46390120 ATTCTTCCCCTGACGATGTG Chr4:46389846..46389865 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TACCCTGGGTGTGTGTGTGT Chr4:46394898..46394918 59.76 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACCCTGGGTGTGTGTGTGT Chr4:46394898..46394918 59.76 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028331