Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10095
Trapped Gene
Grb10 (ENSMUSG00000020176)
Vector Insertion
Chr 11: 11846806 - 11851505
Public Clones XC302 (baygenomics) (cmhd) IST14876C6 (tigm) IST10854E3 (tigm) IST12908A2 (tigm)
IST10783H5 (tigm) IST15062E9 (tigm) IST11753F11 (tigm) IST12652C11 (tigm)
IST12908A3 (tigm) IST10783H5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000101485 (Chr11:11851506..11851662 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000101485 (Chr11:11851506..11851662 -)
Downstram Exon
ENSMUSE00000101493 (Chr11:11846690..11846805 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000518051 Chr11:11937195..11937404 No primer for this exon
upstream ENSMUSE00000681120 Chr11:11927906..11927974 No primer for this exon
upstream ENSMUSE00000520180 Chr11:11887599..11887677 No primer for this exon
upstream ENSMUSE00000493066 Chr11:11870426..11870645 No primer for this exon
upstream ENSMUSE00000711981 Chr11:11870426..11870645 No primer for this exon
upstream ENSMUSE00000101499 Chr11:11867535..11867688 No primer for this exon
upstream ENSMUSE00000101502 Chr11:11857755..11857829 No primer for this exon
upstream ENSMUSE00000101500 Chr11:11854747..11854911 No primer for this exon
upstream ENSMUSE00000101485 Chr11:11851506..11851662 No primer for this exon

*** Putative Vector Insertion (Chr 11: 11846806 - 11851505) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000101493 Chr11:11846690..11846805 No primer for this exon
downstream ENSMUSE00000101465 Chr11:11845967..11846035 No primer for this exon
downstream ENSMUSE00000101470 Chr11:11845498..11845635 No primer for this exon
downstream ENSMUSE00000101472 Chr11:11844819..11844929 No primer for this exon
downstream ENSMUSE00000101469 Chr11:11843885..11843983 No primer for this exon
downstream ENSMUSE00000101498 Chr11:11838413..11838487 No primer for this exon
downstream ENSMUSE00000101496 Chr11:11837810..11837926 No primer for this exon
downstream ENSMUSE00000101483 Chr11:11837004..11837070 No primer for this exon
downstream ENSMUSE00000101476 Chr11:11836721..11836808 No primer for this exon
downstream ENSMUSE00000101486 Chr11:11834202..11834295 No primer for this exon
downstream ENSMUSE00000706158 Chr11:11833162..11833612 No primer for this exon
downstream ENSMUSE00000681119 Chr11:11833097..11833612 No primer for this exon
downstream ENSMUSE00000101495 Chr11:11830511..11833612 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr11:11851435..11851455 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACCTCCGTGACTGGGAAAA Chr11:11851440..11851460 62.38 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTTCCTGGGGAAGGAAACTG Chr11:11848676..11848696 60.98 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTTCCTGGGGAAGGAAACTG Chr11:11848676..11848696 60.98 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020176