Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10101
Trapped Gene
Gsk3b (ENSMUSG00000022812)
Vector Insertion
Chr 16: 38220245 - 38228763
Public Clones XC303 (baygenomics)
Private Clones OST410543 (lexicon)
Severity of mutation (?) Insertion after 87% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000436458 (Chr16:38220058..38220244 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTACCAAATGGGCGAGACAC Chr16:38220196..38220215 60.52 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000436458 (Chr16:38220058..38220244 +)
Downstram Exon
ENSMUSE00000436452 (Chr16:38228764..38228862 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTACCAAATGGGCGAGACAC Chr16:38220196..38220215 60.52 55 GAGCATGTGGAGGGATAAGG Chr16:38228817..38228836 59.51 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000436954 Chr16:38089610..38090699 CTTGCGGGAGAACTTAATGC Chr16:38090505..38090524 59.85 50
upstream ENSMUSE00000700452 Chr16:38090374..38090699 CTTGCGGGAGAACTTAATGC Chr16:38090505..38090524 59.85 50
upstream ENSMUSE00000436937 Chr16:38144346..38144539 GATGGCAGCAAGGTAACCAC Chr16:38144354..38144373 60.53 55
upstream ENSMUSE00000130676 Chr16:38170750..38170833 TCCGACTGCGGTATTTCTTC Chr16:38170796..38170815 60.21 50
upstream ENSMUSE00000130687 Chr16:38184521..38184631 AGTCGAGCCAAGCAGACACT Chr16:38184593..38184612 60.21 55
upstream ENSMUSE00000130691 Chr16:38187897..38188027 GGAATCTGCCATCGAGACAT Chr16:38187945..38187964 60.04 50
upstream ENSMUSE00000130685 Chr16:38191614..38191720 CAGGGCACCAGAGTTGATCT Chr16:38191671..38191690 60.26 55
upstream ENSMUSE00000436470 Chr16:38193983..38194080 CAGTGGTGTGGATCAGTTGG Chr16:38194047..38194066 60 55
upstream ENSMUSE00000475152 Chr16:38208081..38208176 CCTCAAATCAAGGCACATCC Chr16:38208147..38208166 60.46 50
upstream ENSMUSE00000700451 Chr16:38217199..38217237 CTCACCAGGAGCAGGACATT Chr16:38217201..38217220 60.26 55
upstream ENSMUSE00000436458 Chr16:38220058..38220244 CTACCAAATGGGCGAGACAC Chr16:38220196..38220215 60.52 55

*** Putative Vector Insertion (Chr 16: 38220245 - 38228763) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000436452 Chr16:38228764..38228862 GAGCATGTGGAGGGATAAGG Chr16:38228817..38228836 59.51 55
downstream ENSMUSE00000436942 Chr16:38240588..38241236 ATTGGTCTGTCCACGGTCTC Chr16:38240622..38240641 59.97 55
downstream ENSMUSE00000700450 Chr16:38240588..38240865 ATTGGTCTGTCCACGGTCTC Chr16:38240622..38240641 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCGAGACACACCTGCACTCT Chr16:38220208..38220228 61.66 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCGAGACACACCTGCACTCT Chr16:38220208..38220228 61.66 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022812