Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10116
Trapped Gene
Trim59 (ENSMUSG00000034317)
Vector Insertion
Chr 3: 68847689 - 68847765
Public Clones XST034 (baygenomics) XST009 (baygenomics) XST030 (baygenomics) XST047 (baygenomics)
XST027 (baygenomics) XST032 (baygenomics) XST050 (baygenomics) XST028 (baygenomics)
P149B02 (ggtc) P095B01 (ggtc) W265C08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000674481 (Chr3:68847690..68847764 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGATCCTGGAAAAGTTGGA Chr3:68847737..68847757 59.93 42.86 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000674481 (Chr3:68847690..68847764 -)
Downstram Exon
ENSMUSE00000229097 (Chr3:68847690..68847765 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGATCCTGGAAAAGTTGGA Chr3:68847737..68847757 59.93 42.86 TCTCCTGATCTGGACACTGG Chr3:68847680..68847699 58.75 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000674482 Chr3:68848535..68848677 No primer for this exon
upstream ENSMUSE00000229097 Chr3:68847690..68847765 AAGGATCCTGGAAAAGTTGGA Chr3:68847737..68847757 59.93 42.86
upstream ENSMUSE00000674481 Chr3:68847690..68847764 AAGGATCCTGGAAAAGTTGGA Chr3:68847737..68847757 59.93 42.86

*** Putative Vector Insertion (Chr 3: 68847689 - 68847765) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000462170 Chr3:68839215..68841930 AGCCAGCAGTCCAGACACTT Chr3:68840053..68840072 60.06 55
downstream ENSMUSE00000487464 Chr3:68839210..68841930 AGCCAGCAGTCCAGACACTT Chr3:68840053..68840072 60.06 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr3:68847695..68847715 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGATCCTGGAAAAGTTGGA Chr3:68847735..68847755 58.57 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034317