Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10133
Trapped Gene
Ldlr (ENSMUSG00000032193)
Vector Insertion
Chr 9: 21550884 - 21551592
Public Clones XST117 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000217579 (Chr9:21550806..21550883 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCACATGGTATGAGGTTCC Chr9:21550843..21550862 60.2 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000217579 (Chr9:21550806..21550883 +)
Downstram Exon
ENSMUSE00000217571 (Chr9:21551593..21551750 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCACATGGTATGAGGTTCC Chr9:21550843..21550862 60.2 55 GCTCGTCCTCTGTGGTCTTC Chr9:21551712..21551731 59.99 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000638289 Chr9:21528038..21528288 GCAACGCAGAAGCTAAGGAT Chr9:21528204..21528223 59.62 50
upstream ENSMUSE00000290216 Chr9:21536191..21536313 GCAGGAACGAGTTCCAGTGT Chr9:21536206..21536225 60.31 55
upstream ENSMUSE00000217568 Chr9:21536756..21536878 CCAATCAATTCAGCTGTGGA Chr9:21536774..21536793 59.65 45
upstream ENSMUSE00000217581 Chr9:21537935..21538318 GGATGTCGACTGTGTTGACG Chr9:21538128..21538147 60.16 55
upstream ENSMUSE00000217574 Chr9:21539681..21539803 GTGACCGTGAACATGACTGC Chr9:21539750..21539769 60.17 55
upstream ENSMUSE00000217585 Chr9:21541664..21541786 GCCCCAACAAGTTCAAGTGT Chr9:21541679..21541698 60.01 50
upstream ENSMUSE00000217577 Chr9:21542318..21542437 GACCAACGAGTGTTTGGACA Chr9:21542319..21542338 59.57 50
upstream ENSMUSE00000217586 Chr9:21543299..21543424 AACCTGGAAGGCAGCTACAA Chr9:21543346..21543365 59.88 50
upstream ENSMUSE00000217564 Chr9:21543830..21544001 CAGCGAGTACACCAGTCTGC Chr9:21543891..21543910 59.65 60
upstream ENSMUSE00000217569 Chr9:21544093..21544317 GACACCAAGGGCGTAAAGAG Chr9:21544235..21544254 59.73 55
upstream ENSMUSE00000217576 Chr9:21546631..21546749 CTCACTGGTGACCGAAAACA Chr9:21546703..21546722 59.72 50
upstream ENSMUSE00000217583 Chr9:21547101..21547240 CAATCGGAAAACCATTTTGG Chr9:21547174..21547193 60.16 40
upstream ENSMUSE00000217566 Chr9:21548366..21548507 AGCCATTTTCAGTGCCAATC Chr9:21548398..21548417 60.08 45
upstream ENSMUSE00000217588 Chr9:21548674..21548829 AATGGTGGTTGCCAGTACCT Chr9:21548709..21548728 59.33 50
upstream ENSMUSE00000217584 Chr9:21550176..21550349 ACAGTGGCGTCAGTGACAGT Chr9:21550319..21550338 59.36 55
upstream ENSMUSE00000217579 Chr9:21550806..21550883 GCCACATGGTATGAGGTTCC Chr9:21550843..21550862 60.2 55

*** Putative Vector Insertion (Chr 9: 21550884 - 21551592) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000217571 Chr9:21551593..21551750 GCTCGTCCTCTGTGGTCTTC Chr9:21551712..21551731 59.99 60
downstream ENSMUSE00000351661 Chr9:21552585..21554360 CCAGGACCCGGTCAGTAGTA Chr9:21553043..21553062 59.98 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAACCTGGCCATGTCACCTT Chr9:21550905..21550925 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAACCTGGCCATGTCACCTT Chr9:21550905..21550925 60.38 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032193