Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10135
Trapped Gene
Ptprk (ENSMUSG00000019889)
Vector Insertion
Chr 10: 27926063 - 27983306
Public Clones KST236 (baygenomics) XST132 (baygenomics) KST228 (baygenomics) IST14522F10 (tigm)
IST11512A4 (tigm) IST13719B10 (tigm) IST13533C5 (tigm) IST13191F11 (tigm)
IST14601E9 (tigm) IST12482F10 (tigm) IST11430B3 (tigm) IST10886H6 (tigm)
IST11430D8 (tigm) IST11640B4 (tigm) IST14869D1 (tigm)
Private Clones OST395919 (lexicon) OST365755 (lexicon) OST56842 (lexicon) OST56315 (lexicon)
OST46542 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000307517 (Chr10:27925940..27926062 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000307517 (Chr10:27925940..27926062 +)
Downstram Exon
ENSMUSE00000307511 (Chr10:27983307..27983578 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000356900 Chr10:27794626..27794983 No primer for this exon
upstream ENSMUSE00000307517 Chr10:27925940..27926062 No primer for this exon

*** Putative Vector Insertion (Chr 10: 27926063 - 27983306) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000307511 Chr10:27983307..27983578 No primer for this exon
downstream ENSMUSE00000307502 Chr10:28054282..28054363 No primer for this exon
downstream ENSMUSE00000307492 Chr10:28056228..28056343 No primer for this exon
downstream ENSMUSE00000307482 Chr10:28074411..28074585 No primer for this exon
downstream ENSMUSE00000307473 Chr10:28103237..28103530 No primer for this exon
downstream ENSMUSE00000504626 Chr10:28185564..28185866 No primer for this exon
downstream ENSMUSE00000492490 Chr10:28192754..28192863 No primer for this exon
downstream ENSMUSE00000098865 Chr10:28194891..28195092 No primer for this exon
downstream ENSMUSE00000098870 Chr10:28202994..28203099 No primer for this exon
downstream ENSMUSE00000098868 Chr10:28212720..28212993 No primer for this exon
downstream ENSMUSE00000098874 Chr10:28216715..28216751 No primer for this exon
downstream ENSMUSE00000488347 Chr10:28271424..28271562 No primer for this exon
downstream ENSMUSE00000442083 Chr10:28279811..28279971 No primer for this exon
downstream ENSMUSE00000442070 Chr10:28281913..28281948 No primer for this exon
downstream ENSMUSE00000482001 Chr10:28286301..28286485 No primer for this exon
downstream ENSMUSE00000576902 Chr10:28288133..28288220 No primer for this exon
downstream ENSMUSE00000442058 Chr10:28289703..28289779 No primer for this exon
downstream ENSMUSE00000666512 Chr10:28289980..28289997 No primer for this exon
downstream ENSMUSE00000576900 Chr10:28293174..28293210 No primer for this exon
downstream ENSMUSE00000442048 Chr10:28294625..28294722 No primer for this exon
downstream ENSMUSE00000442046 Chr10:28295396..28295512 No primer for this exon
downstream ENSMUSE00000442044 Chr10:28300199..28300353 No primer for this exon
downstream ENSMUSE00000508473 Chr10:28305366..28305501 No primer for this exon
downstream ENSMUSE00000442033 Chr10:28305729..28305878 No primer for this exon
downstream ENSMUSE00000442026 Chr10:28306714..28306887 No primer for this exon
downstream ENSMUSE00000442023 Chr10:28308734..28308865 No primer for this exon
downstream ENSMUSE00000442017 Chr10:28309065..28309190 No primer for this exon
downstream ENSMUSE00000442013 Chr10:28311691..28311854 No primer for this exon
downstream ENSMUSE00000442006 Chr10:28312576..28312711 No primer for this exon
downstream ENSMUSE00000347267 Chr10:28315608..28316046 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr10:27968113..27968133 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGTATGCCAGGCACTTAGC Chr10:27968079..27968099 59.36 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019889