Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10136
Trapped Gene
Ero1l (ENSMUSG00000021831)
Vector Insertion
Chr 14: 45912853 - 45913978
Public Clones XST142 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 58% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000121285 (Chr14:45913979..45914071 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGTGCATTTGAGTGCAAGG Chr14:45913992..45914011 59.72 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000121285 (Chr14:45913979..45914071 -)
Downstram Exon
ENSMUSE00000315554 (Chr14:45912606..45912852 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGTGCATTTGAGTGCAAGG Chr14:45913992..45914011 59.72 45 ACGCTTTGTTTTCTGCATCC Chr14:45912612..45912631 60.26 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000617664 Chr14:45938052..45938237 No primer for this exon
upstream ENSMUSE00000617663 Chr14:45926187..45926306 CCTGGACGACTGTACCTGTG Chr14:45926276..45926295 59.17 60
upstream ENSMUSE00000617662 Chr14:45924924..45925007 AGAGACTGTGCCGTCAAACC Chr14:45924934..45924953 60.31 55
upstream ENSMUSE00000617661 Chr14:45923224..45923262 No primer for this exon
upstream ENSMUSE00000617660 Chr14:45921524..45921597 CCAACCGCATTGAAGAATGT Chr14:45921565..45921584 60.89 45
upstream ENSMUSE00000617659 Chr14:45921368..45921441 GTCAGACAGCTTCTGCGAAA Chr14:45921374..45921393 59.32 50
upstream ENSMUSE00000617658 Chr14:45919517..45919637 TTAACCCTGAGCGCTACACA Chr14:45919579..45919598 59.49 50
upstream ENSMUSE00000617657 Chr14:45918721..45918758 No primer for this exon
upstream ENSMUSE00000689234 Chr14:45915647..45915658 No primer for this exon
upstream ENSMUSE00000121288 Chr14:45914186..45914212 No primer for this exon
upstream ENSMUSE00000121285 Chr14:45913979..45914071 ATGTGCATTTGAGTGCAAGG Chr14:45913992..45914011 59.72 45

*** Putative Vector Insertion (Chr 14: 45912853 - 45913978) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000315554 Chr14:45912606..45912852 ACGCTTTGTTTTCTGCATCC Chr14:45912612..45912631 60.26 45
downstream ENSMUSE00000574627 Chr14:45912037..45912106 TCTCATCGAAGTGCAAAGGA Chr14:45912059..45912078 59.52 45
downstream ENSMUSE00000574626 Chr14:45907651..45907737 CAGCCAACACAGTCCATGAT Chr14:45907660..45907679 59.55 50
downstream ENSMUSE00000121294 Chr14:45907408..45907541 CATAACTTGGTCCGCTTTCC Chr14:45907438..45907457 59.57 50
downstream ENSMUSE00000315526 Chr14:45902879..45905763 ATGAGGCCCATGACTCAAAC Chr14:45904643..45904662 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGTGCATTTGAGTGCAAGG Chr14:45913990..45914010 59.72 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGTGCATTTGAGTGCAAGG Chr14:45913990..45914010 59.72 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021831